ID: 1046021785

View in Genome Browser
Species Human (GRCh38)
Location 8:108674064-108674086
Sequence TACCTAGTTTTGTCAACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046021785 Original CRISPR TACCTAGTTTTGTCAACTCC AGG (reversed) Intronic
902111294 1:14080782-14080804 TAACTTGTTTTGACAACCCCAGG + Intergenic
909067441 1:70952358-70952380 TTCCTAGTTTTGTTAATTCAAGG + Intronic
916781499 1:168035471-168035493 AACCTGGTTTCTTCAACTCCAGG - Intronic
917953049 1:180061401-180061423 TGCCTAGGCTAGTCAACTCCTGG + Intronic
918615083 1:186534830-186534852 CCCCTATTTTTCTCAACTCCTGG - Intergenic
919109604 1:193201166-193201188 TACCTAATTTTGTCTTCTCAAGG - Intronic
921672981 1:217946817-217946839 TTCTTAGCTTTTTCAACTCCCGG + Intergenic
923329863 1:232913036-232913058 TACCTGGTTTTGTCCATTCTGGG - Intergenic
924560163 1:245152110-245152132 TACCCAGTTTTGTCATGTCTGGG - Intergenic
1072550743 10:96475477-96475499 AACCCAAGTTTGTCAACTCCAGG - Intronic
1075140806 10:119833431-119833453 TGCCTAGGCTGGTCAACTCCTGG - Intronic
1075933915 10:126323466-126323488 TACCTCCTTTTGGCAACTCTGGG - Intronic
1079684762 11:23345060-23345082 TCCCTAGTTTTGCCACTTCCAGG - Intergenic
1079840718 11:25395890-25395912 TACGTAGTTATGTCAAATGCAGG + Intergenic
1091898264 12:4121985-4122007 AACCTCGTTTTGCCAACCCCAGG - Intergenic
1091917814 12:4282003-4282025 TCCCCAGTTTTGGAAACTCCAGG - Intronic
1093193962 12:16108297-16108319 TACCTAGTTGTCTCCACTTCTGG - Intergenic
1093816972 12:23560473-23560495 TATCTACCTTTGTCAACTCAAGG + Intronic
1099585494 12:84507993-84508015 GCCCTGGTTTTGTCAACTCCTGG - Intergenic
1102164043 12:110792002-110792024 TCACTAGGTTGGTCAACTCCTGG - Intergenic
1104130217 12:125886306-125886328 TCCATAGTTTTGTCTTCTCCAGG + Intergenic
1107694624 13:42988163-42988185 TACCTAGTTTTATCCAATTCTGG - Intronic
1107717268 13:43212843-43212865 TACCTTGTTTTGTGTCCTCCTGG - Intergenic
1112089545 13:96068478-96068500 TTCCTAGTTTTGGCAATTCTTGG - Intergenic
1116501673 14:45631716-45631738 TACCTGGTTTTATCTACTCTGGG + Intergenic
1116740543 14:48748946-48748968 TACCTATTCTTGGCTACTCCAGG + Intergenic
1120256063 14:82121116-82121138 TTCCTAGTTTTGTCATCTCTTGG - Intergenic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1134400632 16:13906600-13906622 CACATGGTTTTGTCAACTGCGGG + Intergenic
1137992837 16:53177330-53177352 TACCTACTTTTCTCAAATCTGGG - Intronic
1149174185 17:53849613-53849635 TACCTAGTTTTGTCTTCTTATGG - Intergenic
1153118639 18:1692436-1692458 TTTCTAGATTTGCCAACTCCAGG - Intergenic
1155177659 18:23314883-23314905 TTCCTAGCTTTGTCAACGGCTGG + Intronic
1159289207 18:66395247-66395269 TAACTGGCTTTGTCAACTCAGGG + Intergenic
1160198067 18:76773597-76773619 TACTTTGTTATGACAACTCCAGG - Intergenic
1166523472 19:43496477-43496499 TACCAAGTTTGTTCAAATCCTGG + Intronic
926519197 2:13888915-13888937 TATCTAGTTTTCACAACACCAGG - Intergenic
930108808 2:47660120-47660142 TCCTTATTTTTGTCAACTCCTGG + Intergenic
932198174 2:69802239-69802261 TAACTAGTATTCTTAACTCCTGG - Intronic
932832062 2:74999681-74999703 TGCCCAGCTTTGTCAGCTCCAGG - Intergenic
935040635 2:99423332-99423354 GGCCAAGGTTTGTCAACTCCTGG - Intronic
937003043 2:118485672-118485694 TAACTGGTTTTGTCCACTCAGGG + Intergenic
941850683 2:170177127-170177149 TACCTAGATTTATCTGCTCCAGG + Intergenic
945570039 2:211455829-211455851 TACCTAATTTTATCAGTTCCAGG + Intronic
947107579 2:226683647-226683669 TACTTAGTCTTTTCTACTCCAGG - Intergenic
1169684350 20:8253740-8253762 TACCTGAGTTTTTCAACTCCTGG + Intronic
1171183802 20:23110639-23110661 TACTTTGTTTTGTCAGCCCCAGG - Intergenic
1177492810 21:21849385-21849407 TACCTAGTATTATCAACTATGGG + Intergenic
1177514274 21:22127622-22127644 GACCTACTTTTGTAAACTCTTGG - Intergenic
1178195247 21:30337403-30337425 TAAGTAGTTTGGACAACTCCGGG + Exonic
953571353 3:44074271-44074293 CACCTGGCTTTGTCACCTCCTGG + Intergenic
955577296 3:60379755-60379777 TACCTAGTTTTCAGAACACCTGG + Intronic
956636188 3:71367880-71367902 TTCCCAGAGTTGTCAACTCCAGG + Intronic
959805107 3:110541542-110541564 TATCTATTTTTTTTAACTCCTGG + Intergenic
967455476 3:189681147-189681169 CACCTGGTTTTCTCAGCTCCTGG + Intronic
967455481 3:189681237-189681259 CACCTGGTTTTCTCAGCTCCTGG + Intronic
975826218 4:78321816-78321838 GACGAAGTTTTGTTAACTCCAGG - Intronic
976838536 4:89404220-89404242 TAGCCAGCTTTGTCAACTCCTGG + Intergenic
977220231 4:94329484-94329506 TAGCTAGTTTTATCTCCTCCAGG - Intronic
978111252 4:104966528-104966550 TAACTAGTTTTATCAGCCCCTGG - Intergenic
978281644 4:107023426-107023448 TATCTAGTTTTGTCTCATCCAGG - Intronic
978618845 4:110620606-110620628 TTCCTAGTTTTGTGATCTCCGGG - Intronic
979028970 4:115615108-115615130 GACCTGGTTCTGTGAACTCCTGG - Intergenic
983318350 4:166162656-166162678 TACCTATTTTTATAACCTCCAGG - Intergenic
986611463 5:9572240-9572262 TAACTTGTTTTGTCAACTCTTGG + Intergenic
988028437 5:25730111-25730133 TACCTGTTTTTGTGAACTCATGG + Intergenic
988137276 5:27190242-27190264 TTTATAGTTTTGTCAAGTCCAGG + Intergenic
993838398 5:92844558-92844580 TATCTAGTTTTTTAAAATCCAGG + Intergenic
995002572 5:107152433-107152455 TAGCTACTTTTGTCTACACCTGG + Intergenic
996263026 5:121497851-121497873 TACCTAATTTTGTCTAATCTTGG + Intergenic
998056791 5:139085455-139085477 TACCTAGTTTTCCCAACGCCAGG - Intronic
999190370 5:149742664-149742686 TACCTTGTTTAATCAACTACCGG + Intronic
1000640622 5:163697943-163697965 TACCTAAGTCTGTGAACTCCTGG + Intergenic
1001539422 5:172526951-172526973 TACCTAATTTAGACAAATCCTGG - Intergenic
1006674913 6:35755721-35755743 TAGCTTGTTTTCTCAACTACAGG + Intergenic
1010468309 6:76194793-76194815 TACCTAGTGTAGTCAATTCATGG - Intergenic
1016320697 6:142842349-142842371 TACCTAGCTTTGTGAAATCAAGG - Intronic
1017132712 6:151121780-151121802 TACCTGGTTTTACCCACTCCAGG - Intergenic
1018610426 6:165642937-165642959 TACATATTTTTGTCAAAACCTGG + Intronic
1021908278 7:25358329-25358351 TTACTAGTTTTGTAAACTCTGGG - Intergenic
1029211757 7:98914978-98915000 TATTTTGTTTTGTCAAATCCTGG - Intronic
1031281124 7:119800530-119800552 TACCTAGTTATGCCAACCTCTGG - Intergenic
1031345407 7:120659605-120659627 TACTTAGTATTCTCTACTCCTGG - Intronic
1035604874 8:923522-923544 TAACTAGTTATGTCAACTTCAGG - Intergenic
1037090188 8:14905514-14905536 TACCCAGTTTTATCAAATACTGG - Intronic
1041443953 8:57930024-57930046 CAACTAGTTTTGTCAAATCCAGG + Intergenic
1044731713 8:95233719-95233741 TACCTAGGGTCTTCAACTCCTGG + Intergenic
1045679935 8:104647982-104648004 TACCTAGTTTTGCCCACTTTAGG + Intronic
1046021785 8:108674064-108674086 TACCTAGTTTTGTCAACTCCAGG - Intronic
1046583910 8:116127723-116127745 TACCTAGATTTGTGAATGCCTGG - Intergenic
1047593527 8:126352512-126352534 TACCTTGGATTGTCTACTCCTGG - Intergenic
1049711756 8:144067458-144067480 TACCATGATATGTCAACTCCTGG - Intergenic
1053588831 9:39489610-39489632 TCCTTAATTTTCTCAACTCCAGG + Intergenic
1054577472 9:66875685-66875707 TCCTTAATTTTCTCAACTCCAGG - Intronic
1057559019 9:96112777-96112799 TGCCCAGGCTTGTCAACTCCTGG - Intronic
1188192018 X:27182899-27182921 TACCTAGGGTTACCAACTCCAGG + Intergenic
1188813048 X:34676455-34676477 TAACTGGTTTTGTCTACTCAGGG - Intergenic
1196620406 X:117815972-117815994 TACCTAGCTTTGCCAGCTTCTGG - Intergenic
1198676757 X:139139330-139139352 TACCTATTTTTGTGGACTCTTGG - Intronic
1199891772 X:152090786-152090808 TATTTAGTATTGTTAACTCCTGG + Intergenic
1200341787 X:155405031-155405053 AACCTAGTTTTCTCAACTTCGGG + Intergenic