ID: 1046023092

View in Genome Browser
Species Human (GRCh38)
Location 8:108689868-108689890
Sequence CTGGAGAAATGGAGAGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1090
Summary {0: 1, 1: 0, 2: 13, 3: 120, 4: 956}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046023092_1046023100 22 Left 1046023092 8:108689868-108689890 CCCCCTCCTCTCCATTTCTCCAG 0: 1
1: 0
2: 13
3: 120
4: 956
Right 1046023100 8:108689913-108689935 TTATGCAGATAACAGACCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046023092 Original CRISPR CTGGAGAAATGGAGAGGAGG GGG (reversed) Intronic
900993243 1:6107401-6107423 GTGGAGAAATGGAGGGATGGAGG + Intronic
901514551 1:9736242-9736264 CTGGAGAAAGGGAGAGTTGGGGG + Intronic
901565725 1:10113196-10113218 CAGGAGCAACAGAGAGGAGGAGG + Intronic
902041594 1:13496581-13496603 GAGGAAAAATGGAGAGGAAGAGG - Intronic
902376718 1:16033308-16033330 CTGGGGAGATGGGGAGGTGGGGG + Intronic
902688038 1:18091635-18091657 CTTGAAAAATGGGAAGGAGGGGG - Intergenic
902757701 1:18559930-18559952 CTGGAGGAAGGAAGAGAAGGTGG + Intergenic
902792773 1:18780340-18780362 CAGGAGCAAGGGATAGGAGGAGG + Intergenic
902871010 1:19313516-19313538 GTGGACAAGGGGAGAGGAGGAGG + Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903217732 1:21852468-21852490 TTGGAGAGAGGAAGAGGAGGTGG + Intronic
903670316 1:25031431-25031453 CTGGAGAGATGGAAAGATGGAGG + Intergenic
903674344 1:25054810-25054832 CTGGAGGGACGGAGAGGAGGGGG + Intergenic
903737800 1:25541386-25541408 CTGGAGAAAGGGAGAAGGGGAGG + Intergenic
904236259 1:29119333-29119355 AGGTAGAAATGGTGAGGAGGGGG + Exonic
904598704 1:31662283-31662305 CTGGCAAAAAGGAGAGGAAGGGG + Intronic
904778578 1:32927166-32927188 CCAGAGAAATAGAGAGGTGGGGG + Intergenic
905201868 1:36321429-36321451 CTGGAGAAATGGCGGGCAGGAGG + Intronic
905337680 1:37256724-37256746 GAGGAGAGATGGAGAGAAGGAGG - Intergenic
905352529 1:37357448-37357470 CTGGGGGAATGGAGGGGCGGAGG - Intergenic
905446498 1:38031193-38031215 CTGGAGAATGGGCAAGGAGGTGG + Intergenic
905514547 1:38552564-38552586 TAGGAGAAATGGAGAAGAGACGG - Intergenic
905530481 1:38674788-38674810 CTGCAGAAATAGAGGGGCGGGGG + Intergenic
905858517 1:41330712-41330734 CAGGAGAAAAGGAAAGGAGCAGG - Intergenic
905902430 1:41590451-41590473 CTGACAAAATGGAGAGGTGGAGG - Intronic
906321602 1:44820705-44820727 CTGGAAAGATGAAGATGAGGAGG + Intronic
906553461 1:46687203-46687225 CTGGAGAAATATAAAGTAGGGGG + Intronic
906644389 1:47463409-47463431 TTGGAGAAAGGAAGAGGAGAAGG + Intergenic
907110407 1:51921799-51921821 TTAGAAAGATGGAGAGGAGGTGG - Intronic
907289876 1:53406968-53406990 CTGGAAGGATGGAGAGGAGTGGG + Intergenic
908120640 1:60983179-60983201 AGGGAGAAATGGGGAGGAGTGGG + Intronic
908398229 1:63745950-63745972 GTTGAGAACTGGAGAGGATGGGG - Intergenic
909391872 1:75129298-75129320 AAGGAGGAAGGGAGAGGAGGAGG + Intronic
910089479 1:83445405-83445427 CAGTAAAAATGGAGAGGAGGAGG + Intergenic
910258318 1:85272179-85272201 AAGGAGAAATGTTGAGGAGGGGG - Intronic
910276573 1:85455637-85455659 CTGAAGAAATGGAGAGTAAATGG - Intronic
910835349 1:91502900-91502922 CTGGAAAAATGGAAAGGAAGAGG - Intronic
911292461 1:96073875-96073897 AAGGAGAAAATGAGAGGAGGAGG + Intergenic
911419895 1:97627501-97627523 CTGGGGAATTGCAGAGCAGGAGG - Intronic
912414454 1:109498530-109498552 AGGGAGAAATGGAAAAGAGGGGG - Intronic
913435764 1:118845877-118845899 TTGGGGAAATGGAGAGATGGTGG - Intergenic
913488156 1:119352829-119352851 GGTGAGCAATGGAGAGGAGGAGG + Intergenic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
914679147 1:149926919-149926941 CTGGAAAAGTGGAGAAGAGGAGG + Intronic
914680801 1:149936930-149936952 CTGGAAAAGTGGAGAGGAAACGG + Intergenic
914833685 1:151189969-151189991 CTGGGAAAAGGGAGGGGAGGAGG - Intronic
914989620 1:152487025-152487047 CTGGAGAAAAGCAGAGAAGCAGG - Intergenic
915451833 1:156010750-156010772 GTGGAGGAATGGAAAAGAGGGGG - Intronic
915585122 1:156840290-156840312 CAGGGCAAAAGGAGAGGAGGAGG + Exonic
916295371 1:163213435-163213457 CAGAAAGAATGGAGAGGAGGGGG - Intronic
916790831 1:168123683-168123705 CAGGAGAAAGGGAAAGGAGAAGG - Intronic
916827453 1:168456170-168456192 CTGAAGACATGGAGGGCAGGGGG + Intergenic
917063260 1:171063982-171064004 GAGGAGAGATGGAGAGAAGGGGG + Intronic
917176338 1:172239759-172239781 CTGGAGAAAAGAAGAAGCGGAGG - Intronic
917849329 1:179047035-179047057 CTGGAGAATTGAAGGGGAGTTGG + Intronic
917920779 1:179747933-179747955 CTAGGGAAAGGGGGAGGAGGGGG + Intronic
918472419 1:184887550-184887572 GAGGAGAAAAGGAAAGGAGGAGG - Intronic
918528056 1:185486584-185486606 CTGGAGAAGTGGAATGGAGCGGG + Intergenic
918716046 1:187788296-187788318 CTGGAGAAATAGGAAGCAGGCGG - Intergenic
918722818 1:187875598-187875620 CAGGAGAAATAGAGGGGAGAGGG + Intergenic
918784746 1:188750931-188750953 GTAGAAAAAGGGAGAGGAGGGGG - Intergenic
918981413 1:191564763-191564785 CTGGAGAAATGCAGAAGAAAGGG + Intergenic
919087185 1:192934218-192934240 CTGAAGAGATGGAGTGGAGGTGG - Intergenic
919714339 1:200759852-200759874 GGTAAGAAATGGAGAGGAGGAGG + Intronic
919838766 1:201594333-201594355 CAGGAGAAAGGGAGGGGAGGAGG + Intergenic
920030543 1:203035104-203035126 CTGAAGAAATGGGGAGGGCGGGG - Intronic
920106298 1:203555901-203555923 CAGGAGAGACGGAGAGGAGGGGG + Intergenic
920244710 1:204578970-204578992 CTGGTGAAACCGAGAGGAGGAGG + Intergenic
920256688 1:204660173-204660195 CGGGAGACCTGGAGAGGAGCAGG - Intronic
920295619 1:204954421-204954443 CTGGGTAAATGGAGAGTGGGGGG + Intronic
920298311 1:204973446-204973468 GTGCAGTAGTGGAGAGGAGGGGG - Intronic
920846284 1:209595620-209595642 CTGGAGAAATGAAGATGCTGGGG - Intronic
920948784 1:210553781-210553803 AGGGAGAGAGGGAGAGGAGGAGG - Intronic
921146320 1:212361411-212361433 CTGGAGAATTGCAGAGGAAGGGG - Exonic
921299909 1:213742052-213742074 CTAGAGGAATGGCCAGGAGGGGG + Intergenic
921384549 1:214555338-214555360 TTGGAGTAATGGAGAGAAGTGGG + Intergenic
921568150 1:216745598-216745620 CTGGACAAAGGGAAAGGAGGGGG - Intronic
921906527 1:220501360-220501382 CTGGAGCAGGGGACAGGAGGAGG - Intergenic
922061962 1:222101367-222101389 CTGAAGGAGTGGAGCGGAGGTGG - Intergenic
923621286 1:235581548-235581570 CAGGAGAAAGAGAGAGAAGGGGG - Intronic
924145932 1:241074689-241074711 CTGGAGTGAGGGTGAGGAGGAGG - Intronic
924465377 1:244294652-244294674 CTAGAGAAATGTCAAGGAGGGGG - Intergenic
924753045 1:246914888-246914910 CAGTAGAAATGGAGAAGATGGGG - Intronic
924793503 1:247274858-247274880 CTGTTGCAATGGAAAGGAGGGGG + Intergenic
1062956897 10:1546481-1546503 GAGGAGAAATGGTGAGGAGATGG + Intronic
1063311105 10:4952800-4952822 CTGGAGAAATGCAGAGATGCAGG + Intronic
1063316693 10:5013595-5013617 CTGGAGAAATGCAGAGATGCAGG - Intronic
1063802712 10:9598785-9598807 ATGGAGAAATGGACAGGTGAAGG - Intergenic
1063857883 10:10275069-10275091 CTGGAGAAGTGGACAGGGAGAGG - Intergenic
1065247111 10:23769384-23769406 CAGGAGCAATTGAGGGGAGGGGG + Intronic
1065355828 10:24840594-24840616 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1066196596 10:33106369-33106391 CTAGTGATATGGACAGGAGGTGG + Intergenic
1067188682 10:44051829-44051851 CTGGAGAAATGGGGGAGAGTGGG + Intergenic
1067430336 10:46238743-46238765 TGGGAGAAAAGGAGAGGAAGAGG - Intergenic
1067463280 10:46474155-46474177 CTGGAGAGAAGAAGAGGTGGGGG - Intergenic
1067623914 10:47910483-47910505 CTGGAGAGAAGAAGAGGTGGGGG + Intergenic
1068013204 10:51480912-51480934 CTGGAGAATGGGGGAGGTGGTGG + Intronic
1069151949 10:64973434-64973456 CTGGAGATTTGAAGAGGAAGGGG + Intergenic
1069214355 10:65800843-65800865 TGGAAGAAATGGAGAGGAAGAGG - Intergenic
1069312051 10:67050298-67050320 CTCAAGAAAGGGAGAGCAGGAGG - Intronic
1069930801 10:71880441-71880463 CTGGAGAGGTGGAGAGGTGGAGG - Intergenic
1069940961 10:71954952-71954974 CTGGACTAGTGGAGAGGAGCAGG + Intergenic
1069977982 10:72231121-72231143 ATGGAGAAATGGTCTGGAGGGGG - Intronic
1070163708 10:73881929-73881951 CAGGAGAAATGGAGGGGAGGGGG + Intergenic
1070267457 10:74917777-74917799 GTGGAGAAATGGAGTGGAAGAGG + Intronic
1070597902 10:77845581-77845603 AGGGAGAAATGGAGGGAAGGAGG + Intronic
1070654997 10:78265353-78265375 AGGGAGCAAGGGAGAGGAGGAGG + Intergenic
1070782332 10:79144970-79144992 ATGGAGGGATGGCGAGGAGGTGG - Intronic
1071062370 10:81587898-81587920 ATGGAGAAAGGGAGAGAATGGGG - Intergenic
1071102112 10:82050793-82050815 CTGGAGAGACAGAGAGTAGGAGG - Intronic
1071764364 10:88645636-88645658 CTACAGAAAGGGAGAGGATGGGG + Intergenic
1072534000 10:96345980-96346002 CTATAGAAATGGAAAGAAGGAGG - Exonic
1072661404 10:97365796-97365818 AAGGAGAAAGGAAGAGGAGGGGG + Intronic
1073107938 10:101043202-101043224 GTGGAGAGAGGGAAAGGAGGAGG - Intergenic
1073243625 10:102074339-102074361 CTGGAGAAAAGTAGGGAAGGTGG + Intergenic
1074164777 10:110865499-110865521 CTGCAGACATAGAGGGGAGGGGG + Intergenic
1074446820 10:113527510-113527532 CTCTAGAAATGCTGAGGAGGGGG + Intergenic
1074525792 10:114261978-114262000 CAGGAGCAAGAGAGAGGAGGAGG + Intronic
1074701539 10:116096962-116096984 CTGGGGAAAGGGACATGAGGGGG - Intronic
1074982798 10:118633272-118633294 CTGGAGAAATGGATCAGAAGAGG + Intergenic
1075252769 10:120896332-120896354 ATGGAAAAATGGAGAGTATGGGG + Intronic
1075279107 10:121123463-121123485 CCAGAGCAATGGAGAAGAGGTGG + Intergenic
1075345494 10:121679175-121679197 CTGGGGATAGAGAGAGGAGGGGG + Intergenic
1075811424 10:125227476-125227498 GTGGAGACAAGAAGAGGAGGTGG - Intergenic
1075885881 10:125898606-125898628 CTGTAGCTAAGGAGAGGAGGAGG + Intronic
1075915537 10:126163019-126163041 CGGGAGAAAGTGAGAGGAAGGGG - Intronic
1076230758 10:128818150-128818172 CTGGAGATTTGGAGAGGAGATGG - Intergenic
1076382197 10:130031664-130031686 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
1076467849 10:130697348-130697370 ATGAAGAAATGGACAAGAGGGGG + Intergenic
1077076350 11:704154-704176 CAGGAGAACTGGAGATGGGGTGG - Intronic
1077343763 11:2037281-2037303 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1077455695 11:2678602-2678624 CTTAAGTAATGGAGATGAGGGGG - Intronic
1077464561 11:2727480-2727502 CTCGAGGAATAAAGAGGAGGAGG + Intronic
1077480899 11:2814087-2814109 ATGGAGAGATGGAGGGAAGGAGG + Intronic
1077528146 11:3081094-3081116 CTGGAGAGGTGGTGAGGAGGTGG + Intergenic
1078254462 11:9646083-9646105 CTGGAAACATGGGAAGGAGGAGG + Intergenic
1078484242 11:11706909-11706931 CTGGCGAAATGGAGACAGGGAGG + Intergenic
1078493829 11:11796310-11796332 CAGGTGGAATGGAGAGGAGAGGG - Intergenic
1078775119 11:14386779-14386801 CTTGAGGAGTGGTGAGGAGGAGG - Intergenic
1078868953 11:15326312-15326334 TTGGGGAAGTGGAGAGGAGAAGG + Intergenic
1079131749 11:17750743-17750765 TTTCAGAAATGCAGAGGAGGAGG - Intronic
1079485907 11:20935772-20935794 GGTGAGGAATGGAGAGGAGGAGG + Intronic
1080238556 11:30099945-30099967 CTGGAGAAAGGAAGAAGAGATGG - Intergenic
1080427730 11:32171764-32171786 CTAGAGAAATAGTGAGTAGGAGG + Intergenic
1080787981 11:35493440-35493462 CTGGATAGATGGAGAGAGGGAGG - Intronic
1080788524 11:35498716-35498738 TTTGAGAAATGGAGAGAAGGTGG - Intronic
1081565482 11:44258349-44258371 CTGGAGGAATGGGGTGGATGAGG + Intergenic
1081662078 11:44894432-44894454 CTAGAGAGAAGGAAAGGAGGCGG - Intronic
1082823854 11:57563395-57563417 CAGGAGAATTGGAGAGGCAGAGG + Intronic
1082985242 11:59163292-59163314 AAGGAGAAAGGGAGAGGTGGGGG + Intergenic
1083042736 11:59703320-59703342 ATGGAGAAATGGAGCAGTGGAGG - Intergenic
1084430572 11:69108518-69108540 GTGAAGACACGGAGAGGAGGAGG + Intergenic
1084461614 11:69299459-69299481 CAGGGGAGATGCAGAGGAGGGGG + Intronic
1084923742 11:72495016-72495038 CTGGAGAAAGCTAAAGGAGGAGG - Intergenic
1084941661 11:72616427-72616449 CTGGAGACCTGGAGAGGGGCAGG - Intronic
1085046251 11:73355518-73355540 TTGGAGAACTGTGGAGGAGGAGG - Exonic
1085254293 11:75163777-75163799 AAGGAGACAGGGAGAGGAGGAGG - Intronic
1086103113 11:83122211-83122233 CTGGAGAAATGGAATGAAAGAGG - Intergenic
1086132996 11:83420291-83420313 GTAGAGACATGGAGAGAAGGGGG - Intergenic
1086589416 11:88494566-88494588 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1086853024 11:91833525-91833547 TTGGAAGAAGGGAGAGGAGGAGG + Intergenic
1087665267 11:101038175-101038197 AAGAAGAAAGGGAGAGGAGGAGG - Exonic
1088384062 11:109232783-109232805 CTACAGAAATGAAGAGTAGGGGG - Intergenic
1088502564 11:110497291-110497313 TTGGAGATTTGGTGAGGAGGTGG + Intergenic
1088655742 11:111998251-111998273 CTGGAGATATAGAGATGAAGAGG + Intronic
1088688279 11:112303516-112303538 AAGGAGAAAAGGAGAGGAGAGGG + Intergenic
1088815956 11:113421090-113421112 CTGGAGGTATGGAGGAGAGGTGG - Intronic
1089520573 11:119059931-119059953 CTGGGGAAAGGGGGAGGGGGAGG + Intergenic
1089525810 11:119095642-119095664 GGGGAGAAAAGGCGAGGAGGAGG + Intergenic
1089570939 11:119409110-119409132 GTGGGAATATGGAGAGGAGGCGG - Intergenic
1090121612 11:124035179-124035201 CTCGAGAAATGTAGGAGAGGTGG + Intergenic
1090531239 11:127593064-127593086 TTGATGAAATGGAGAGGAGGAGG + Intergenic
1090718212 11:129449352-129449374 ATGGAGTAATGGAGAGAAGCAGG + Intronic
1202826749 11_KI270721v1_random:92470-92492 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1091449306 12:562592-562614 CTGGAGGCAGGGAGAGGAGTGGG + Exonic
1091819113 12:3461309-3461331 TTGGAGGAATGGAGAAGAGATGG + Intronic
1091885445 12:4013840-4013862 GGGGAGAAAGAGAGAGGAGGAGG - Intergenic
1092239470 12:6828333-6828355 AAGGAGAGATGGAGAGGCGGAGG - Intronic
1092651068 12:10635649-10635671 CTGGATAAATGGAGAAGAATGGG - Intronic
1092923747 12:13255972-13255994 CGGGACAAAGGGAGAGGAGGCGG + Intergenic
1093055804 12:14554612-14554634 CTGGAGCAAGGGACAGGAGGAGG - Intronic
1093711279 12:22333026-22333048 CTGGGGAGGTGGAGAGGAAGGGG + Intronic
1094034108 12:26048394-26048416 CTGGAGTGGTAGAGAGGAGGGGG + Intronic
1094097926 12:26728525-26728547 CTGGATAATAGGAGAGAAGGTGG + Intronic
1095203322 12:39410899-39410921 CTGGAGGAATGGAGGGAGGGAGG + Intronic
1095382112 12:41607407-41607429 CTGAATGAATGGAGGGGAGGGGG + Intergenic
1095544898 12:43354795-43354817 CTGGAGAAAAGTATAGAAGGTGG + Intronic
1095660475 12:44727501-44727523 GTGGAAAAATGGAGAAGAAGAGG + Intronic
1095912439 12:47442321-47442343 GTGGAGAAATGGGGAAGAAGGGG + Intergenic
1095965657 12:47865260-47865282 TTGGAGAAATGGAGACCAGGGGG - Intronic
1096134529 12:49188562-49188584 CTGGGGACCGGGAGAGGAGGAGG - Intronic
1096492939 12:52023035-52023057 CGAGCGGAATGGAGAGGAGGCGG + Intronic
1096659952 12:53118237-53118259 GTGGAGAAATGGATAGGGTGGGG - Intronic
1097021173 12:56021664-56021686 CTGAGGAGATGGAGAGGATGGGG + Intronic
1097183507 12:57184204-57184226 CCGGAGAAAGGGTGAGGAGCTGG + Exonic
1097397849 12:59097762-59097784 AAGGAGAAAGGGAGAGAAGGAGG + Intergenic
1098055208 12:66497724-66497746 CAGCAAAAATGGAGAGGAGCAGG + Intronic
1098645697 12:72898041-72898063 CTGTAGACGAGGAGAGGAGGTGG + Intergenic
1098948678 12:76616455-76616477 CTGGAGAGATGGAATGGAGGGGG + Intergenic
1098987741 12:77030508-77030530 CTGGATAAATGGTTAGGATGGGG + Intronic
1099092982 12:78337289-78337311 GTGGAGAAATAAAGAGGAAGTGG + Intergenic
1099532378 12:83800476-83800498 ATGGGGAAATAGGGAGGAGGAGG - Intergenic
1099569908 12:84304403-84304425 CTTGAGAAAGGGGGAGGAGGTGG - Intergenic
1100235104 12:92652921-92652943 GGAGAGAAATGGAGAGAAGGGGG - Intergenic
1100419564 12:94418416-94418438 CAGCAGAAATAGAGAGGAAGAGG + Intronic
1101465989 12:104949914-104949936 TTAGAGAAATTGAGGGGAGGTGG + Intronic
1101699639 12:107160302-107160324 CTAGAGAAAGGGAGGAGAGGAGG + Intergenic
1101715131 12:107304394-107304416 CTGGAAAAATGAAGAGCATGAGG + Intergenic
1102469094 12:113149574-113149596 GTGGTGCAATGGAGAGGATGGGG - Intergenic
1102575468 12:113853607-113853629 CTGGGTAAAGAGAGAGGAGGTGG + Intronic
1103626680 12:122225643-122225665 GAGGAGACGTGGAGAGGAGGAGG - Intronic
1103938361 12:124488624-124488646 CTGGAGGGAGGGAGTGGAGGAGG + Intronic
1104080388 12:125425052-125425074 GTTGAGACATGGGGAGGAGGTGG + Intronic
1104090851 12:125516560-125516582 CTGGGAAATTGGAGAGGAGCAGG + Intronic
1104106639 12:125666374-125666396 ATGGGAGAATGGAGAGGAGGTGG + Intergenic
1104375376 12:128261467-128261489 TGGGAGAAATGCAGAGGAGAAGG + Intergenic
1104776348 12:131392282-131392304 TTGGAGATTGGGAGAGGAGGAGG - Intergenic
1104959135 12:132479920-132479942 CTGGAGAAATGGGGAGGAAAGGG + Intergenic
1105032008 12:132890515-132890537 GTAGAGACATGGAGAGAAGGGGG - Intronic
1105042652 12:132972698-132972720 AAGCAGAAATGGAGAGGAGGAGG - Intergenic
1105292598 13:19062256-19062278 CTGGATAAATGGTGATGTGGGGG - Intergenic
1105553105 13:21417000-21417022 ATGAAGAAATGGTGAGGAAGAGG - Intronic
1105583738 13:21724712-21724734 CTGGAGAAAAGCAGAGGCTGTGG - Intergenic
1105718561 13:23091595-23091617 CTCGAGAAAAGGAGAGGGGCTGG - Intergenic
1106003726 13:25749468-25749490 CTGGAGAAAAGCAGAGCAGTGGG + Intronic
1106045684 13:26139164-26139186 TTGGAGAAATGGAGTGGTTGGGG - Intronic
1106419754 13:29576550-29576572 CTGCAGAAAGTGAGAGAAGGAGG + Intronic
1106465370 13:30009412-30009434 CTGGAGAAAGGTACAGGAAGGGG - Intergenic
1106519185 13:30482245-30482267 AAAGAGAAAGGGAGAGGAGGAGG - Intronic
1106619166 13:31357027-31357049 CTGGAGGAACTGAGAGGAAGAGG - Intergenic
1107025586 13:35798176-35798198 CTAGAGAAATGGAGACCAGGAGG - Intronic
1107053406 13:36076988-36077010 GTGGAAAGCTGGAGAGGAGGAGG + Intronic
1107592024 13:41919112-41919134 CTGGAGAACTGCAAAGGAGTAGG + Intronic
1107677619 13:42813134-42813156 CAGGAGGAATAGAGAGCAGGAGG - Intergenic
1107839082 13:44436989-44437011 CTGGAGAATGGGGGCGGAGGTGG - Intronic
1108166563 13:47699423-47699445 CTGTGGAAAGGGAGAGGAAGAGG - Intergenic
1108264694 13:48694807-48694829 GTGGGGGAATGGAGAGGAAGGGG + Intronic
1109042691 13:57359780-57359802 TAGGAGAAATCGAGGGGAGGGGG + Intergenic
1109273872 13:60283099-60283121 CTAGAGAGATGGAGAGAGGGAGG - Intergenic
1109329435 13:60909876-60909898 CTAAATAAATGGAGAGGAGTTGG + Intergenic
1109391100 13:61694851-61694873 CAGGAGGAAGAGAGAGGAGGGGG - Intergenic
1109759117 13:66803630-66803652 CTAGAGTAATGGAGAGGAAAGGG - Intronic
1110119863 13:71866900-71866922 AAGGAGAAAGGGAGAGAAGGGGG + Intronic
1111330870 13:86761130-86761152 CTGGGGGAATGAGGAGGAGGCGG + Intergenic
1111460805 13:88539568-88539590 CTGGAAGAATTTAGAGGAGGAGG + Intergenic
1111528655 13:89508034-89508056 TTGGAGCAAGAGAGAGGAGGTGG + Intergenic
1112421957 13:99260397-99260419 GTGAAGAAATGGAGAGGTTGGGG + Intronic
1112543389 13:100339731-100339753 CTGGAGAAAAGGAGAGCGGCTGG - Intronic
1112706872 13:102080261-102080283 CTGGAGTTATGCAGTGGAGGTGG + Intronic
1112837260 13:103531281-103531303 CTATAGAAATGGAGATGAAGGGG - Intergenic
1113246633 13:108403685-108403707 CTGGCTAAATAGAGAGCAGGTGG + Intergenic
1113664104 13:112128842-112128864 TTGGAGAAAAGGAAAAGAGGCGG - Intergenic
1113966370 13:114155725-114155747 GTGGAGAAGTGGGGAGGAGTGGG + Intergenic
1114011073 14:18369302-18369324 CTGGAGATATAAAGAGGAGCGGG - Intergenic
1114391794 14:22317103-22317125 TTGGAGAAATGAAGAGGGTGGGG + Intergenic
1114402067 14:22419227-22419249 CTGGAGAGATGGAGATTATGGGG + Intergenic
1114552992 14:23544827-23544849 ATGGAGAAATGGCGAGCCGGAGG - Intronic
1114624388 14:24119356-24119378 CTGGGGAAATGGAGAGCAAGGGG - Intronic
1115921555 14:38379791-38379813 TTGGGGAAAGGGAGAGAAGGAGG + Intergenic
1116948318 14:50856658-50856680 CAGGAGGAATGGAAAAGAGGAGG - Intergenic
1117202252 14:53403279-53403301 CTGGAGAAATGGAGGTGAGATGG - Intergenic
1117211373 14:53503893-53503915 ATGGACAAATGGAGAGGAGAAGG + Intergenic
1117434412 14:55702440-55702462 CAGGAGGAATGAAGAGGAAGAGG + Intergenic
1118091664 14:62487518-62487540 TTGGAAAAATGGAGAGGAAGAGG - Intergenic
1118347834 14:64952491-64952513 CTGGTGAGCTGGGGAGGAGGAGG - Exonic
1118756657 14:68849731-68849753 CTGGAGAAAAGCAGGGGATGGGG + Intergenic
1118763729 14:68896235-68896257 CGAGAGAAAGGGAGAGGATGAGG - Intronic
1118895519 14:69942561-69942583 CTGGAGATAAGGAGAGAAGCAGG - Intronic
1119186822 14:72649037-72649059 TGGGAGAAAGGGAGAAGAGGAGG - Intronic
1119529270 14:75348265-75348287 CTCCAGAAATGGAAATGAGGAGG - Intergenic
1120255005 14:82107378-82107400 CTGGAGAGATGGAAAGTGGGAGG + Intergenic
1120491624 14:85185305-85185327 TTGGAGAAATGAAGGGGAGCAGG - Intergenic
1121004562 14:90481364-90481386 CAGAAGAATTGGAGAGGAAGAGG - Intergenic
1121060556 14:90904698-90904720 CTCTATAAATGGAGCGGAGGTGG - Intronic
1121504480 14:94466115-94466137 CTGGGGATAGGAAGAGGAGGTGG - Intronic
1121592330 14:95125607-95125629 AGGGAGAAGGGGAGAGGAGGAGG + Intronic
1121777075 14:96598140-96598162 CAGGAGAAAGGGAGAGGAGGGGG - Intergenic
1121894969 14:97638301-97638323 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1121991133 14:98558692-98558714 CTAGAGAAATGGAGAGAACTTGG - Intergenic
1122027511 14:98888388-98888410 CTAGAAGAAAGGAGAGGAGGAGG - Intergenic
1122541807 14:102502216-102502238 AGGGAGAAAGGGAGAGAAGGGGG + Exonic
1122887704 14:104717876-104717898 ATGGAAAAAGGGAGGGGAGGGGG - Intronic
1123178652 14:106446137-106446159 CTGAAGAAAGAGAGAGGAGGTGG - Intergenic
1202862428 14_GL000225v1_random:90811-90833 CAGGAGATATGAAGAGGAAGGGG + Intergenic
1202868448 14_GL000225v1_random:137339-137361 CCGGAGAAACGAAGAGGAAGGGG + Intergenic
1124009923 15:25830125-25830147 ATGGAGCCACGGAGAGGAGGAGG + Intronic
1124216632 15:27812928-27812950 GTGGGGAAGTGGGGAGGAGGAGG - Intronic
1124370676 15:29103306-29103328 CTGGAGAGGTGGGGAAGAGGAGG - Intronic
1125191814 15:37002291-37002313 CTGCAGAAGCGGGGAGGAGGAGG - Intronic
1125281445 15:38046072-38046094 TTAGGGAAATGGAGAAGAGGGGG - Intergenic
1125412363 15:39418632-39418654 TTGGGGAAAGGGATAGGAGGGGG - Intergenic
1125724172 15:41859809-41859831 CTGCAAGAATGGAGAGGGGGTGG + Intronic
1126245366 15:46498786-46498808 CTGCACAAATGGAAAGGAGTAGG - Intergenic
1126411112 15:48374105-48374127 GGGGAGAAATGGGGAGGAGGAGG - Intergenic
1126430314 15:48576549-48576571 CTGGAGGAATGAAGGGAAGGTGG + Intronic
1127575210 15:60285143-60285165 CTAGAGTAAGGGAGAGGATGGGG + Intergenic
1127613189 15:60657241-60657263 ATGGGGAGAGGGAGAGGAGGAGG - Intronic
1127821142 15:62657181-62657203 ATGGAGAAACTGGGAGGAGGAGG + Intronic
1128864989 15:71108128-71108150 ATGGAGACATTGAGATGAGGTGG + Intronic
1128958728 15:71976996-71977018 TTGGAGAAACTGAGATGAGGTGG - Intronic
1129184894 15:73899988-73900010 CTGGAGACAGGCAGAGGGGGCGG - Intergenic
1129262857 15:74378528-74378550 CGGGTGAAGGGGAGAGGAGGAGG - Intergenic
1129659634 15:77545844-77545866 CTGAAGAAATGGGGAGCAGGGGG + Intergenic
1129677578 15:77640705-77640727 CTGGAGGAGTCCAGAGGAGGTGG + Intronic
1129689892 15:77707204-77707226 AGGGAGAAATGGTGGGGAGGAGG + Intronic
1129915286 15:79264789-79264811 CTTGAAAAAAGGAAAGGAGGGGG + Intergenic
1130312538 15:82767863-82767885 CTGGAGAAATGAAGAGGTGTTGG - Intronic
1130459972 15:84153617-84153639 AGGGAGAAAGGGAGAGGAGGAGG + Intergenic
1130461778 15:84164633-84164655 CTGGAGAAAAGGAGGGGGAGAGG - Intergenic
1131056096 15:89376030-89376052 CTGGGGTAATGGAGAGGACAAGG - Intergenic
1131559275 15:93425099-93425121 ATGGAGAAATTGAGGGCAGGAGG - Intergenic
1131610853 15:93961901-93961923 GTGCAGAAATTCAGAGGAGGAGG + Intergenic
1131672079 15:94630873-94630895 CTGGGTAAAGGGAGAGGAGAGGG + Intergenic
1132101826 15:99029106-99029128 CTGCAGAAATTGTGGGGAGGTGG + Intergenic
1132532768 16:461522-461544 CTGAGGAACGGGAGAGGAGGTGG - Intronic
1132913660 16:2329695-2329717 CTGGGGAACTGGCCAGGAGGAGG + Exonic
1134005815 16:10818401-10818423 CTGGAGAAGCCGGGAGGAGGAGG - Intronic
1134194673 16:12150192-12150214 GTGGAGAAGTGGATAGGAGGAGG + Intronic
1134511364 16:14850340-14850362 CTAGAGAAAGAGGGAGGAGGGGG + Intronic
1134527897 16:14958354-14958376 CAGGAGGAAGGGAGAGAAGGGGG - Intergenic
1134692057 16:16197590-16197612 CAGGAGAGAGGAAGAGGAGGAGG + Intronic
1134699008 16:16248837-16248859 CTAGAGAAAGAGGGAGGAGGGGG + Intronic
1134972829 16:18545836-18545858 CTAGAGAAAGAGGGAGGAGGGGG - Intronic
1135395614 16:22129586-22129608 TTGGAGACATTAAGAGGAGGAGG + Intronic
1135409888 16:22225656-22225678 CTGGACAAATGCAGAGGCGAAGG - Exonic
1135499118 16:22978391-22978413 ATGGAGAGATGGAGAGATGGAGG + Intergenic
1135589038 16:23692091-23692113 CTGGAGGATGGAAGAGGAGGAGG + Intronic
1135711988 16:24725523-24725545 CTGGGGAGGGGGAGAGGAGGGGG - Intergenic
1136141914 16:28293466-28293488 GTGGGGGAAGGGAGAGGAGGAGG - Intronic
1136143546 16:28302186-28302208 CTGGAAAACTGGAGAGAAGGAGG + Intronic
1136297660 16:29312885-29312907 CTTGAGGAAGAGAGAGGAGGAGG + Intergenic
1136465882 16:30443367-30443389 CTTGAAAGATGGAAAGGAGGTGG - Intergenic
1136684844 16:31988118-31988140 TTGGAGGAATGAATAGGAGGGGG + Intergenic
1136785458 16:32931653-32931675 TTGGAGGAATGAATAGGAGGGGG + Intergenic
1136884314 16:33922151-33922173 TTGGAGGAATGAATAGGAGGGGG - Intergenic
1137063061 16:35809785-35809807 CAGGAGAAAAGGAGGGGAGAGGG + Intergenic
1137403347 16:48171171-48171193 CTGGGGGACTGGGGAGGAGGTGG - Intronic
1137432233 16:48427684-48427706 CAGGAGAGAGGGAGAGGTGGAGG - Intronic
1137491643 16:48938004-48938026 CTGGAGATGTGGAGAGAGGGAGG + Intergenic
1137534132 16:49304716-49304738 CTGGGGAAAGGGAGTGGAGAAGG + Intergenic
1137590877 16:49692637-49692659 TTGGAGAAAGGATGAGGAGGAGG + Intronic
1137774062 16:51041025-51041047 AGGGAGAAAGGGAGGGGAGGAGG + Intergenic
1137798461 16:51241256-51241278 CAAGAGAAATAGGGAGGAGGAGG + Intergenic
1137881954 16:52058647-52058669 ATGGAGAAATCAAGAGGAGGTGG - Intronic
1138521568 16:57574375-57574397 CTGCAGAGATGGTGATGAGGTGG + Intronic
1138567169 16:57841902-57841924 CTTGAGAAGAGGGGAGGAGGTGG - Intronic
1139194016 16:64897224-64897246 CTAGAGAACTGGGAAGGAGGTGG + Intergenic
1139270592 16:65678998-65679020 CTGGAAAAATAAAAAGGAGGAGG + Intergenic
1139298329 16:65922334-65922356 GTGGAGCAGTGGAGAGGAGAGGG - Intergenic
1139306873 16:65994114-65994136 CTGAAGCAATGGAGAAAAGGAGG + Intergenic
1139363615 16:66419277-66419299 AAGGAGGAATGGGGAGGAGGAGG + Intergenic
1139670138 16:68487277-68487299 CTGGGGACATGGAGAGTGGGTGG - Intergenic
1140602284 16:76491506-76491528 CTGGAGAGCTGGAAATGAGGGGG - Intronic
1141392432 16:83676067-83676089 CAGGAAAGAAGGAGAGGAGGAGG + Intronic
1141482906 16:84318601-84318623 ATGGAGAATTGAAGGGGAGGGGG + Intronic
1141507339 16:84486555-84486577 CTGGAGAAAGGGAGAGGGTGGGG - Intronic
1142059211 16:88018963-88018985 CTTGAGGAAGAGAGAGGAGGAGG + Intronic
1142359730 16:89620362-89620384 GTTGAGAAATGGAGAGGAGGGGG - Intronic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142889830 17:2936052-2936074 GTGGAGACAGGGAGAGGAGATGG - Intronic
1143180397 17:4980799-4980821 GAGGGGAAATGGAGAGGGGGAGG - Intronic
1143262986 17:5614172-5614194 CTGGAGAGACGGTGAGGAAGGGG - Intronic
1143417402 17:6759763-6759785 CCTGAGAAAAGGAGAGGAAGGGG + Intronic
1143683051 17:8491924-8491946 GTGGGGACCTGGAGAGGAGGAGG - Intronic
1143702091 17:8668232-8668254 TGGGAGAAATGGAGAGAAGATGG - Intergenic
1143737350 17:8922118-8922140 CTGGAGAATAGGAAAGAAGGAGG + Intronic
1143880745 17:10027847-10027869 TTGGAGAGATGGAGGGGCGGTGG - Intronic
1144064317 17:11611082-11611104 GTGAGGAAATGGGGAGGAGGAGG - Intronic
1145974676 17:28977338-28977360 CTGAAGTCATGGAGGGGAGGCGG - Intronic
1146561056 17:33871094-33871116 CAGGAGGAAGGGAGAGGAGGAGG - Intronic
1146604030 17:34242815-34242837 TTCGAGAAATGGAAATGAGGAGG + Intergenic
1146762412 17:35490081-35490103 CTGGGGCACTGGGGAGGAGGGGG - Intronic
1147015959 17:37491251-37491273 CTTGAGAAATGCAGGGAAGGAGG + Intronic
1147145785 17:38483799-38483821 TTGGAGGAATGAATAGGAGGGGG + Intronic
1147488846 17:40844841-40844863 CTGGACAAAGGGAGATGAGATGG + Intergenic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1147742087 17:42675515-42675537 GTGGATAAATATAGAGGAGGGGG - Intronic
1148236440 17:45972243-45972265 CTGAAGAAAGAGAGAGGAGGGGG - Intronic
1148325687 17:46782279-46782301 CTGCTGAGAGGGAGAGGAGGAGG + Intronic
1148475903 17:47928299-47928321 CTGGGCACATGGAGTGGAGGTGG - Exonic
1148819190 17:50350746-50350768 ATGGTGAAAAGCAGAGGAGGAGG + Intronic
1149038809 17:52162287-52162309 GTGCAGAAATGTAGAGGAGTAGG - Intergenic
1149242040 17:54662485-54662507 CTGGAGAAATGGACAGAAGTAGG - Intergenic
1149541585 17:57471863-57471885 CTGGAGGAGAGGAGAGGAGAGGG + Intronic
1150165832 17:62941629-62941651 ATGGTGAAATGGAGAAGAGGTGG + Intergenic
1150237560 17:63605300-63605322 CAGTAGAAAGGGAGAGGATGGGG + Intronic
1150767644 17:68014863-68014885 CTGGAAAGATAGAGGGGAGGGGG - Intergenic
1150929062 17:69564842-69564864 CTGGAGAAAAGGAGACCCGGAGG + Intergenic
1151155482 17:72121162-72121184 GAGGCGAATTGGAGAGGAGGAGG - Exonic
1151186870 17:72371209-72371231 CTGGAGAGAAGGGGAGAAGGGGG - Intergenic
1151507864 17:74541293-74541315 CTGGAGAAATGGAAGGGTGCAGG + Exonic
1151536711 17:74743091-74743113 ATGGAGAAATGGTCAGAAGGAGG - Intronic
1152253414 17:79223617-79223639 CGTGAGACATGGAGAGGATGCGG + Intronic
1152285700 17:79411496-79411518 ATGGAGACCTGGAGGGGAGGTGG - Intronic
1153055385 18:940792-940814 CTGAAGAAAAGGAGAAAAGGAGG - Intergenic
1153532170 18:6058287-6058309 CTGGAGCAATGTAGAGAATGAGG - Intronic
1153647437 18:7207769-7207791 CCAGAGAAAAGAAGAGGAGGAGG - Intergenic
1153807041 18:8717724-8717746 CTGTAGAATGGGAGGGGAGGGGG + Intronic
1154110885 18:11567561-11567583 TTGGAGAATGGCAGAGGAGGAGG + Intergenic
1154315946 18:13303474-13303496 AAGGAGAAAAGGAGAGAAGGAGG - Intronic
1155325305 18:24658504-24658526 TGGGGGAGATGGAGAGGAGGAGG + Intergenic
1156410176 18:36820483-36820505 CTTCAGAATTGGTGAGGAGGTGG + Intronic
1156484047 18:37453620-37453642 CAGGAGCAATGGCAAGGAGGTGG + Intronic
1156568294 18:38221522-38221544 ATGGGGAAAAGGAGAGAAGGGGG + Intergenic
1157308161 18:46531882-46531904 GTGGAGAAAAGGATAGGAGTAGG + Intronic
1157493587 18:48139908-48139930 CTGGAGGAAGGGAGCTGAGGAGG - Intronic
1157583595 18:48787372-48787394 CAGGAGGAAGGGAGAGAAGGAGG + Intronic
1157791219 18:50532894-50532916 CTGGGTAAGTGCAGAGGAGGAGG + Intergenic
1158158533 18:54453231-54453253 CAGGAGAGAGAGAGAGGAGGGGG + Intergenic
1158278085 18:55790599-55790621 CTATAGAAATAGAGAGCAGGAGG + Intergenic
1159029253 18:63214134-63214156 CGGGAGAAATGGAAGGGAGAGGG + Intronic
1159058058 18:63486233-63486255 CTGAAGAGTTGGAGAAGAGGTGG + Intronic
1159438651 18:68449428-68449450 ATGAAGAAATGAAGAGGATGAGG - Intergenic
1159598538 18:70406574-70406596 CTGGAGGAAGAGAGTGGAGGGGG + Intergenic
1159777958 18:72625358-72625380 TTAGAGAGATGGGGAGGAGGAGG - Intronic
1159815193 18:73065239-73065261 CTGCAGCAATGTGGAGGAGGTGG + Intergenic
1159946494 18:74447906-74447928 CTGGTGACCTGGAGAAGAGGAGG + Intronic
1160265379 18:77337287-77337309 TTGGAGAAAGGGAGGGGACGGGG - Intergenic
1160448581 18:78946837-78946859 GAGGAGAAGGGGAGAGGAGGAGG + Intergenic
1161249046 19:3270730-3270752 GTGGAGGCCTGGAGAGGAGGGGG + Intronic
1161403808 19:4080953-4080975 CAGGAGGAAAGGAGAGGGGGAGG + Intergenic
1161581342 19:5082683-5082705 CTCGAAGACTGGAGAGGAGGTGG + Intronic
1161597382 19:5157527-5157549 CAGCAGACATGGAGAAGAGGAGG - Intergenic
1161848440 19:6725730-6725752 CTGGGAAAATGGAGAGCAGTGGG + Intronic
1161880188 19:6944416-6944438 AGGGAGAAATGGAGAGAAGTAGG + Intergenic
1162015459 19:7844486-7844508 CTGGGAGAATGGGGAGGAGGTGG - Intronic
1162018148 19:7856707-7856729 CTGGAGAGTGGGAGAGGAGGGGG - Intronic
1162145619 19:8610968-8610990 CGGGAGAAATCGAGTGGCGGCGG + Intergenic
1162576293 19:11500943-11500965 TTGGAGAAGTGGACAGGAGAGGG - Intronic
1162941330 19:14011343-14011365 TTGGAGAAATGGGTAGGAGGTGG - Intergenic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1163677759 19:18663769-18663791 CTGGAGAAGAGGGGATGAGGGGG + Intronic
1163838023 19:19587925-19587947 CTGGGTGAAGGGAGAGGAGGGGG + Intronic
1164162321 19:22635305-22635327 CTGGAGAAATGGGGTGTGGGGGG - Intronic
1164234812 19:23322909-23322931 AGGAAGAAAAGGAGAGGAGGAGG - Intronic
1164249604 19:23465594-23465616 AGGAAGAAAAGGAGAGGAGGAGG - Intergenic
1164292445 19:23880379-23880401 GAGGAGAGAAGGAGAGGAGGAGG + Intergenic
1164307745 19:24019737-24019759 CTGGAGGAATGGGGAGAAAGGGG + Intergenic
1164598667 19:29546823-29546845 ATGGAAAACTGGAGAGGAGGTGG + Intronic
1164729538 19:30492229-30492251 ATGCAGAAATGGAGAGAAAGGGG - Intronic
1165340923 19:35211718-35211740 CTGGAGGAAGGAAGAGGTGGTGG + Intergenic
1165389165 19:35528446-35528468 GTTGAGCAATGGAGAGGAGGAGG + Intergenic
1165395809 19:35563071-35563093 ATGGAGAAATAGAGAGAGGGAGG - Intronic
1166112278 19:40629826-40629848 TTGGAGAAATAGACAGGAGGAGG - Intergenic
1166251681 19:41575843-41575865 CTGGAGCACTGGAGAGCATGAGG + Intronic
1166283293 19:41809198-41809220 CTGGAGGGAGGGAGAGAAGGAGG + Intronic
1166301109 19:41912767-41912789 GTGGAGACACGGAGAGAAGGGGG + Intronic
1166411028 19:42555522-42555544 CTGGAGGAAGGGAGCGGGGGAGG - Intronic
1166763704 19:45239995-45240017 CAGGAGAAATGAAGGGGATGAGG - Intronic
1166851912 19:45765313-45765335 ATGGAGACCTGGACAGGAGGTGG + Exonic
1166987922 19:46673238-46673260 CTGGAGAACTGGGGAGGTGGAGG + Intergenic
1167112843 19:47472006-47472028 CCGGAGAGAGGGGGAGGAGGCGG + Exonic
1167374385 19:49103317-49103339 CTGGAGACAGGCAGAGGACGTGG - Intronic
1167609499 19:50500481-50500503 CTGCAGAAAGGGAGAGGGAGGGG - Intergenic
1167642514 19:50689292-50689314 CAGGAGAAATGGGGGGGTGGTGG + Intronic
1168099537 19:54133917-54133939 GTGGAGAGAGGGAGGGGAGGTGG - Intergenic
1168099605 19:54134102-54134124 GTGGAGAGAGGGAGGGGAGGTGG - Intergenic
1168276883 19:55283893-55283915 CTGGAGGGATGGAGAGGAGGTGG - Intronic
925392757 2:3508937-3508959 GGGGAGAAAAGGAGAGGAGAGGG + Intronic
926041121 2:9674039-9674061 CTGGAGAGAAGGATAAGAGGTGG + Intergenic
926048859 2:9730347-9730369 GTGGAGGATTGGAGAGGAAGGGG - Intergenic
926138578 2:10354963-10354985 CTGCAGAGATGAAGATGAGGAGG + Intronic
926314264 2:11697800-11697822 CTGGTGAGATGGGGAGGAGGGGG - Intronic
926628752 2:15118100-15118122 CTGGATAGCTGGAGAGCAGGAGG - Intergenic
926665864 2:15522266-15522288 CACTAGAAATGGGGAGGAGGAGG + Intronic
926704526 2:15827249-15827271 CTGGAGGCAAGGAGAGGAGCTGG - Intergenic
926794314 2:16606373-16606395 CTGGAGAGAGAGAAAGGAGGAGG - Intronic
927002419 2:18811943-18811965 TTGGAGAAGTGGAGGGGAGAGGG + Intergenic
927392050 2:22606665-22606687 TTGGAGAGATGGAGGGGAAGTGG + Intergenic
927438546 2:23091466-23091488 ATGGACAAATGGAAAGGAAGTGG - Intergenic
927851554 2:26503193-26503215 GGGGAGAAATGGAGAGGACAGGG - Intronic
927935267 2:27072384-27072406 GGGGAGGAATGGAGAAGAGGAGG + Intergenic
927969534 2:27296610-27296632 CAGGAGAAAAGGGGAGGAGCAGG + Intronic
928103899 2:28455243-28455265 GTAGAGAAAGAGAGAGGAGGAGG + Intergenic
928166500 2:28976464-28976486 CTCGAGAGATGGAGGGCAGGGGG - Intronic
928316316 2:30249491-30249513 CTGGAGTAAGTGAAAGGAGGAGG + Intronic
928687346 2:33762178-33762200 CTGGGGAGAGGGAGAGGGGGAGG + Intergenic
928994751 2:37276034-37276056 CTGGAGTAAGGGTGAGGAGTGGG - Intronic
929122799 2:38497151-38497173 CAGGAGAACAGGAGAGGAAGAGG + Intergenic
929426249 2:41847269-41847291 GTGGGGAATTGGAGAGGGGGTGG + Intergenic
929765099 2:44837671-44837693 CTGGACAAATGGGGATGAGTTGG + Intergenic
930361588 2:50387183-50387205 CAGGAGGAATGAAAAGGAGGTGG + Intronic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
930765969 2:55085412-55085434 CTGGAGACCTGGAGAGGAGTGGG + Intronic
930934813 2:56935791-56935813 ATGGAGAAAAGGAAAGGAGCAGG + Intergenic
931430511 2:62205536-62205558 TTTGAGAAAGGGAGAAGAGGCGG + Intronic
931994180 2:67824015-67824037 CTAGAGGAGTGGAGAGGAGAGGG - Intergenic
932039804 2:68287214-68287236 CAGCAGAAAAGGAGAGTAGGTGG + Intronic
932061005 2:68497441-68497463 CAGGAGAAAGAGAGAGAAGGGGG - Intronic
932295628 2:70621512-70621534 GTAGAGACATGGAGAGGAAGAGG - Intronic
932471619 2:71962964-71962986 CCGGAGGAAGGGTGAGGAGGAGG + Intergenic
932580590 2:72990502-72990524 CAGTAGCAATGAAGAGGAGGGGG + Intronic
933457978 2:82541276-82541298 GTGGAGAAGTGGAGAGGGTGAGG - Intergenic
933472448 2:82743066-82743088 CTGGAGAAATGGAGAGTTCAAGG - Intergenic
933674326 2:85040467-85040489 CAGGAGAAATGGAAAAGAGGTGG - Intronic
933775854 2:85770792-85770814 TTGGAAAAAGAGAGAGGAGGAGG - Intronic
934018428 2:87916640-87916662 CAGGAGAAAGAGAGACGAGGGGG - Intergenic
934615361 2:95767401-95767423 CTGGAGAGTAGGAGAGGAGAGGG - Intergenic
934645544 2:96057158-96057180 CTGGAGAGTGGGAGAGGAGAGGG + Intergenic
934838948 2:97613247-97613269 CTGGAGAGTGGGAGAGGAGAGGG + Intergenic
935177236 2:100660290-100660312 AAGCAGAAATGGAGAGAAGGAGG + Intergenic
936922407 2:117702371-117702393 CTGGGCAAATGGAGAGGTGGTGG - Intergenic
936981478 2:118269181-118269203 CGGGAGAGATGGAGGGGAGGAGG + Intergenic
937072047 2:119071882-119071904 CTGGAGAAATAAGCAGGAGGAGG + Intergenic
937164081 2:119795422-119795444 CAGGAGAAAGGCCGAGGAGGGGG - Intronic
937207031 2:120243428-120243450 CTGGAGCCATGGGGAGGAGCAGG + Intronic
937236919 2:120436733-120436755 CTGGAGAAACGGAGCAGAGGAGG - Intergenic
937339234 2:121080348-121080370 GTGGAGAAATGGACACTAGGTGG - Intergenic
937340349 2:121087105-121087127 ATGGACAGATGGACAGGAGGAGG - Intergenic
937790653 2:125957681-125957703 CTGAAGAAAAGGAGACCAGGAGG - Intergenic
938120086 2:128626994-128627016 CGGGAGGGAGGGAGAGGAGGAGG + Intergenic
938134901 2:128748782-128748804 CTCTAGGAATGGAGAGGATGGGG + Intergenic
938186353 2:129235346-129235368 CTGGGTAAAGGGTGAGGAGGTGG + Intergenic
938610123 2:132938719-132938741 CTGGAGAAAGGTAGAGGAAAGGG + Intronic
939547530 2:143571654-143571676 CTGGAGAAGTAGAAAGGATGAGG - Intronic
939665421 2:144945532-144945554 CTGGGTAAGTGCAGAGGAGGAGG - Intergenic
939691686 2:145269830-145269852 CTGGAGAAAAGGAAAGGGGTTGG - Intergenic
940143497 2:150521683-150521705 CAGGGGAAGTGGAGAGGGGGAGG - Intronic
940215873 2:151303117-151303139 CTGGACACATGGAGGAGAGGGGG + Intergenic
940333783 2:152503401-152503423 CTGGGGAATGGGAGAGGATGAGG + Intronic
940728019 2:157357614-157357636 CTGAACAAATAGAGAGGATGGGG - Intergenic
940974365 2:159926860-159926882 CTGAAGCTATGGAGAGGAGCAGG + Intergenic
941126280 2:161587776-161587798 CTGGGGAAATGGGGAGATGGTGG - Intronic
941544548 2:166832281-166832303 ATGGAGAAACGGAGAGGGAGAGG - Intergenic
941968839 2:171328206-171328228 CTGGATAGAGGGAGAGGAGAAGG + Intronic
942338118 2:174913235-174913257 CTGGAGAAATGCAGGGGAAATGG + Intronic
942535021 2:176954294-176954316 CGGAAGAAATGAAGAGAAGGAGG + Intergenic
942763144 2:179424043-179424065 CTTGAGAAATGGAGAGAATTAGG - Intergenic
942933137 2:181520518-181520540 CTGGATTAAAGGAGAGGAGAAGG + Intronic
943436093 2:187867398-187867420 CTGGAGACCCGGAGAGGAGCTGG - Intergenic
943436373 2:187869430-187869452 CTGGAGACCTGGGGAGGAGCAGG - Intergenic
943472681 2:188314418-188314440 CATGAAAAATGGAGAGGGGGAGG - Intronic
943748385 2:191486106-191486128 CAAGGGAAATGGAGAGGAGTGGG - Intergenic
943942412 2:194015344-194015366 CTGGAAAATTGGAGAGAAGGTGG - Intergenic
944320963 2:198341654-198341676 CTGGTGGAATGCAGAGGACGTGG + Intronic
944637596 2:201689825-201689847 CAAGTGAGATGGAGAGGAGGCGG + Intronic
945100488 2:206258238-206258260 CTTGAGAAACTGAGAGGAGGTGG + Intergenic
945414923 2:209559175-209559197 CTTTAGAAAAGGAGAGGAGTTGG - Intronic
945463921 2:210145183-210145205 CAGGAGAAAAAGAGATGAGGAGG - Intronic
945519966 2:210814211-210814233 CAGGAGCAATGGAGAGAAGTAGG + Intergenic
945618112 2:212098885-212098907 CAGGAAAATTGGAGAAGAGGTGG + Intronic
945932991 2:215874666-215874688 CTCGAGAAATGGAGAGTATGAGG - Intergenic
946285307 2:218698197-218698219 ATGGACTGATGGAGAGGAGGAGG - Intronic
946391589 2:219419589-219419611 CTGGAGAAAAAGGGAGTAGGTGG + Intronic
946406154 2:219493049-219493071 ATGGAGAAGTGGAGAGGAAAAGG + Exonic
946531797 2:220578320-220578342 CTTGAGAAAGGGAAAGGAGATGG + Intergenic
946613174 2:221481059-221481081 CTGGAGAGTTAGAGAGGAGAAGG - Intronic
946911365 2:224464503-224464525 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
947190964 2:227504141-227504163 CTGGAGAGGTGGAGGGGAGGCGG + Intronic
947547829 2:231023730-231023752 CTGGAGAAATGGTGTGGACGAGG - Intronic
947564267 2:231184067-231184089 CTGGAGAGCTGAGGAGGAGGCGG + Intergenic
947619551 2:231580808-231580830 CTGGAGGAAGGGGGAGGACGCGG + Intergenic
947752619 2:232540701-232540723 CTGGAGAACAAGTGAGGAGGGGG + Exonic
947826029 2:233106611-233106633 CTGGAGAAGCCCAGAGGAGGAGG - Intronic
948064480 2:235066964-235066986 CTGGAGAGGAGGGGAGGAGGGGG + Intergenic
948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG + Intergenic
948842173 2:240657169-240657191 CTGGGGAGCTGGGGAGGAGGGGG + Intergenic
949071114 2:242024849-242024871 CTGGAGACCTGGGGAGGAGCTGG + Intergenic
1168857003 20:1015585-1015607 AGGGAGAAATGGAGTGAAGGAGG - Intergenic
1168875016 20:1165332-1165354 CTTGGGAAGTGGAGAGGAGCTGG - Exonic
1169275174 20:4228877-4228899 CTGGAGACGTGGAGAGAAGAAGG - Intronic
1169692350 20:8345680-8345702 CTGGAGAAAGGGCAAGGTGGAGG + Intronic
1169705117 20:8495073-8495095 ATGGAGAAAGGGAGAAGAGGTGG + Intronic
1169804342 20:9544023-9544045 CTGGAGACATGCAGATGAGCAGG - Intronic
1169874186 20:10278865-10278887 CTGGAGGAGTGGGAAGGAGGTGG + Intronic
1169930168 20:10824036-10824058 TTGGAGGAATGGAGAGGATATGG + Intergenic
1170272068 20:14538344-14538366 CTGGAGCAATGGAGGAGAGATGG + Intronic
1170694365 20:18645303-18645325 CTGCAGAAATGGAAACAAGGAGG + Intronic
1170816933 20:19721532-19721554 TTGAAGAAATAGAGAGGAGGGGG + Exonic
1170939269 20:20835074-20835096 CTGGACAAATGGGGATGAGTTGG - Intergenic
1171217607 20:23363158-23363180 CTGGAGAAGGGGAGAGGGGTGGG + Intronic
1171960037 20:31486664-31486686 ATGGAGAGATGGAGGGGAGCGGG - Intergenic
1172523976 20:35586482-35586504 AGGGAGAAAGGGAGAGAAGGGGG - Intergenic
1172583415 20:36065654-36065676 CTGGACAGCTGGAGAGAAGGTGG - Intergenic
1172736908 20:37133410-37133432 CTTCAGAGATGGAGAGGAGGAGG - Intronic
1172806963 20:37619018-37619040 AAGGAGAAAGGGAGAGGAGAGGG - Intergenic
1173149260 20:40551540-40551562 AAGGAGAAAGGGAGAGAAGGAGG + Intergenic
1173399706 20:42713821-42713843 CTGGAGGAAGAGAGAGGGGGAGG - Intronic
1173509930 20:43619288-43619310 CTGGAGAAGCGGAGAGGAACAGG + Intronic
1173648060 20:44646022-44646044 CTGGGGAGGTGGAGAGGAGCAGG - Intronic
1173662348 20:44743473-44743495 CGGGAGAGAGAGAGAGGAGGGGG - Intergenic
1173827271 20:46055952-46055974 CTGGGGTTCTGGAGAGGAGGTGG + Intronic
1174058950 20:47819025-47819047 CAGGAGGAAAGCAGAGGAGGTGG + Intergenic
1174060991 20:47833015-47833037 CTGGAGACCTGGACAGGAGCTGG - Intergenic
1174061141 20:47833898-47833920 CTGGAGACAGGGGGAGGAGCCGG - Intergenic
1174070635 20:47896801-47896823 CTGGAGACAGGGGGAGGAGCCGG + Intergenic
1174070906 20:47898355-47898377 CTGGAGACCTGGACAGGAGCTGG + Intergenic
1174100197 20:48121427-48121449 CTGGAGACCTGGACAGGAGCTGG - Intergenic
1174100297 20:48122012-48122034 CTGGAGACAGGGGGAGGGGGCGG - Intergenic
1174100466 20:48122928-48122950 CTGGAGACAGGGGGAGGAGCCGG - Intergenic
1174100597 20:48123688-48123710 CTGGAGATCTGGACAGGAGCTGG - Intergenic
1174148992 20:48472880-48472902 CTGGAGACCTGGAGAGGAGATGG - Intergenic
1174149054 20:48473297-48473319 CTGGAGACCAGGAGAGGAGCTGG - Intergenic
1174149202 20:48474273-48474295 CTGGAGAACCAGGGAGGAGGTGG - Intergenic
1174149227 20:48474430-48474452 CTGGAGACCTAGAGAGGAGCTGG - Intergenic
1174149300 20:48474902-48474924 CTGGAGAACTGGAGAGGAGATGG - Intergenic
1174153154 20:48500304-48500326 CTGGAGACCTGGACAGGAGCTGG - Intergenic
1174153264 20:48500922-48500944 CTGGAGACCTGGGGAGGAGCCGG - Intergenic
1174153463 20:48502040-48502062 CTGGAGACCTGGGGAGGAGCTGG - Intergenic
1174165486 20:48580893-48580915 ATGGAGAAAAAGAGAGCAGGAGG - Intergenic
1174170601 20:48615952-48615974 CAGGAGCCATGGAGAGTAGGAGG - Intergenic
1174356384 20:50000936-50000958 CTGAGGCAATGGCGAGGAGGAGG + Intergenic
1174421885 20:50404662-50404684 CTGGAGGAAGGGAGATAAGGAGG - Intergenic
1174907455 20:54566409-54566431 TCCCAGAAATGGAGAGGAGGGGG - Intronic
1174932874 20:54834451-54834473 CTGGAGAAGGGGAAAGGAGGAGG + Intergenic
1175110523 20:56644843-56644865 CAGGGGAAGTGGAGAGTAGGGGG + Intergenic
1175156387 20:56974516-56974538 CTAGAGAATTGGGGTGGAGGTGG - Intergenic
1175219193 20:57407318-57407340 AAGGAGACATGGAGTGGAGGAGG + Intronic
1175277026 20:57779145-57779167 TTAGAGAAATGAAGAGGTGGGGG + Intergenic
1175323449 20:58106160-58106182 CAAGAGAAATGGAGAGCCGGGGG + Intergenic
1175600909 20:60272166-60272188 AGGGAGAATTGGAGTGGAGGTGG + Intergenic
1175743333 20:61435956-61435978 CTGGAGAAGGCGAGGGGAGGTGG - Intronic
1175829828 20:61957559-61957581 CTGGAGAATCAAAGAGGAGGAGG + Intronic
1175935117 20:62510605-62510627 GTGGAGGGATGGAGAGGTGGAGG - Intergenic
1175935122 20:62510621-62510643 GTGGAGGGATGGAGAGGTGGAGG - Intergenic
1175935130 20:62510644-62510666 GTGGAGGGATGGAGAGGTGGAGG - Intergenic
1175935175 20:62510753-62510775 GTGGAGGGATGGAGAGGTGGAGG - Intergenic
1176342388 21:5710447-5710469 CTGGAAACATGGAGGGGCGGAGG - Intergenic
1176474642 21:7142599-7142621 CTGGAAACATGGAGGGGCGGAGG - Intergenic
1176502439 21:7614009-7614031 CTGGAAACATGGAGGGGCGGAGG + Intergenic
1176536709 21:8108516-8108538 CTGGAAACATGGAGGGGCGGAGG - Intergenic
1177515541 21:22147128-22147150 CAGGAGAAAGAGAGAGAAGGTGG - Intergenic
1177550422 21:22613893-22613915 CTGGAGAAGTGGGGAGGAAGAGG + Intergenic
1178375536 21:32064588-32064610 AGGGAGAAAGAGAGAGGAGGAGG + Intergenic
1178403298 21:32305515-32305537 CTGCAGAAGTTCAGAGGAGGAGG + Intronic
1178683225 21:34690806-34690828 CTGGGGAAAAGAAAAGGAGGGGG - Intronic
1178740429 21:35195131-35195153 CATGAGAGGTGGAGAGGAGGTGG - Intronic
1179129198 21:38619334-38619356 CAAGAGGAATAGAGAGGAGGAGG - Intronic
1179464061 21:41559789-41559811 CAGAAGAAATGAAGAGGAGAAGG + Intergenic
1179958687 21:44756039-44756061 CTGGAGTGATGGAGAAGAAGAGG + Intergenic
1179964798 21:44796332-44796354 CTGCAGAAATTCAGAGGTGGTGG - Intronic
1180285904 22:10744137-10744159 CTGTAGCTAAGGAGAGGAGGAGG + Intergenic
1180435567 22:15300106-15300128 CTGGAGATATAAAGAGGAGCGGG - Intergenic
1180517758 22:16163920-16163942 CTGGAGATATAAAGAGGAGCTGG - Intergenic
1180570976 22:16718307-16718329 CTGGAGAAATGAACTGGAGGAGG + Intergenic
1181268306 22:21643629-21643651 CTGGGAAAATGTGGAGGAGGAGG + Intronic
1181740305 22:24916208-24916230 CTGGGGAGATGGAGGGGATGGGG - Intronic
1181887211 22:26030801-26030823 CTGGCCAAGTGAAGAGGAGGAGG - Exonic
1182035725 22:27196831-27196853 CTGGAGACATGCAGAGGAAAGGG - Intergenic
1182288041 22:29259491-29259513 ATGGGGACATGGAGAGGAAGGGG + Exonic
1182730129 22:32482342-32482364 TTGGAGAAATGGAGGGGAGCCGG - Intronic
1182882631 22:33746831-33746853 CTGGAGCCCAGGAGAGGAGGAGG + Intronic
1183951531 22:41355534-41355556 CTGGAGAAACGGGCAGGTGGTGG + Exonic
1183968785 22:41460239-41460261 CTGGGTGAAGGGAGAGGAGGGGG + Exonic
1184008170 22:41725950-41725972 CTGCAGCAAGGAAGAGGAGGAGG + Intronic
1184488541 22:44795962-44795984 CTGCAGACATGGAAAGGAGTAGG - Intronic
1184885381 22:47341893-47341915 CTGGAGAAGTGGAGGGGTTGGGG + Intergenic
1184956400 22:47889712-47889734 CAGGAGAAAGAGAGAGGGGGAGG - Intergenic
1185236825 22:49718747-49718769 CTGGAGAATGAGAGAGGAGAGGG - Intergenic
1203241657 22_KI270733v1_random:24927-24949 CTGGAAACATGGAGGGGCGGAGG - Intergenic
949159298 3:860726-860748 CTGGAGACATGGAGAGGAGCGGG - Intergenic
949159397 3:861464-861486 CTGGAGATCTGGGGAGGAGCTGG - Intergenic
949365156 3:3272599-3272621 CTGGGGGAGTGCAGAGGAGGGGG + Intergenic
949535014 3:4988848-4988870 CTGGAGGGAGGGAGAGAAGGAGG + Intergenic
950040380 3:9916056-9916078 CTGGAGTTCTGGAGAGGAAGTGG - Exonic
950443379 3:13022621-13022643 CTGGGGAAATGGGGAGGATGTGG - Intronic
950459854 3:13114877-13114899 GTGAAGATTTGGAGAGGAGGTGG + Intergenic
950484394 3:13264535-13264557 CTGGAGGGAGGGAGGGGAGGAGG - Intergenic
950617367 3:14171871-14171893 CTAGAGAAAAGGAGAAGAGATGG + Intronic
950887223 3:16372948-16372970 CTGGAGACAAGGAGATGATGGGG - Intronic
951274208 3:20665399-20665421 ATGGAGAAAGGGAGAGGGAGAGG - Intergenic
951320065 3:21233745-21233767 CTGAAGCAAAGAAGAGGAGGAGG - Intergenic
951815575 3:26750458-26750480 CTGCAGAAATGGGGAGCTGGAGG - Intergenic
951857549 3:27214590-27214612 CTCTGGAAATGGTGAGGAGGTGG - Intronic
952214045 3:31258298-31258320 TTGGAGAAATGGAGAGATGTTGG - Intergenic
952755136 3:36859116-36859138 GTGGGGAGCTGGAGAGGAGGCGG - Intronic
953075990 3:39570778-39570800 CTGGAGAAGTGAAGGGGAAGTGG - Intergenic
953349692 3:42206066-42206088 CTGGAGAAATGGAAAGAAAGAGG + Intronic
953383235 3:42489957-42489979 CTGAAGAAATGGAGGGTCGGAGG - Intronic
953475390 3:43201665-43201687 CCAGAGCAATGGAGATGAGGGGG + Intergenic
954659806 3:52221037-52221059 CTGGAGGCATGGACAGGAGGAGG - Intergenic
955497779 3:59553755-59553777 GGAGAGAAATGGAAAGGAGGTGG + Intergenic
955851483 3:63224725-63224747 CTGGAGAAATTGAGGAGAGAAGG + Intergenic
955942411 3:64158897-64158919 CTGGATCAAAGAAGAGGAGGTGG - Intronic
956109734 3:65858634-65858656 TTGGAGAAGAGGAAAGGAGGAGG + Intronic
956466135 3:69522471-69522493 CTGGAGTATGGGGGAGGAGGAGG - Intronic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956861458 3:73327924-73327946 TTGTAGAAATAGAGAGGAGGAGG - Intergenic
956878644 3:73488863-73488885 CAGCAGAGATGGGGAGGAGGGGG - Intronic
957243476 3:77688900-77688922 CTGTAGAAATGCAGGAGAGGAGG + Intergenic
960035695 3:113101073-113101095 ATGAGGAAATGGGGAGGAGGTGG - Intergenic
960092058 3:113650818-113650840 CTGGGGAAAGAGAAAGGAGGGGG - Exonic
960141919 3:114159343-114159365 AGGGAGAGATGGAGAGAAGGTGG - Intronic
960352280 3:116607773-116607795 CTGGAGAAGTTGAGAGCAGTGGG + Intronic
960429919 3:117556776-117556798 CAGGAGGAAGGGAGAGAAGGGGG - Intergenic
960533478 3:118791525-118791547 GAGGTGAAATTGAGAGGAGGAGG - Intergenic
960806689 3:121590487-121590509 CAGAAGGAAGGGAGAGGAGGAGG - Intergenic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961201042 3:125045650-125045672 GTGGAAAATTGGAGAGGAGTTGG - Intronic
961510282 3:127396615-127396637 CGGGAGGAATGCAGAGGGGGCGG + Intergenic
963085880 3:141436121-141436143 ATGAAGAAATGTAGTGGAGGAGG + Intronic
963833382 3:150032401-150032423 CTGGAGCAAAGGAGAATAGGAGG + Intronic
964007635 3:151851255-151851277 ATGGAGAAATGGACAGAAGTAGG - Intergenic
964010982 3:151891266-151891288 CTGTAGACATGCTGAGGAGGTGG + Intergenic
964791882 3:160460456-160460478 CAGCAGGAATGGAGAGGTGGGGG + Intronic
965332033 3:167387635-167387657 GTGGAGAAAGAGAGAAGAGGTGG + Intergenic
965396631 3:168166915-168166937 ATGTAGAAATGGAGAGTGGGAGG + Intergenic
965540660 3:169868175-169868197 TGGGAGACATGGAGAGGAAGGGG - Intronic
965835757 3:172850370-172850392 ATTGAGAAATGGAGAGAAGAAGG + Intergenic
967138340 3:186531462-186531484 CCAGAGAAATGGAGGGCAGGAGG + Intergenic
967836485 3:193968589-193968611 ATGGAGCAAGAGAGAGGAGGAGG + Intergenic
967856488 3:194121645-194121667 CTGGAGAGCAGGAGAGCAGGAGG - Intergenic
967934359 3:194715019-194715041 CAGGAGCACTGGTGAGGAGGAGG - Intergenic
968049428 3:195644030-195644052 CTGAAGACCTGGAGAGGAGGTGG + Intergenic
968097975 3:195945596-195945618 CTGAAGACCTGGAGAGGAGGTGG - Intergenic
968106441 3:196004979-196005001 CTGAAGACCTGGAGAGGAGGTGG - Intergenic
968131813 3:196196636-196196658 CTGGGGAAGTGGAGGGGTGGGGG - Intergenic
968186122 3:196634543-196634565 CTGGAGAACTGGAGAAGTGGGGG + Intergenic
968305190 3:197645902-197645924 CTGAAGACCTGGAGAGGAGGTGG - Intergenic
968312130 3:197692616-197692638 GTAGAGAATTGGAGAGGAGTTGG + Intronic
968825748 4:2895498-2895520 CTGGGGAAAGGGAGAGGTTGAGG + Intronic
969185442 4:5470985-5471007 CTGCAGAGATTGAAAGGAGGCGG - Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969247040 4:5941845-5941867 CTAGTGAAAGTGAGAGGAGGAGG - Intronic
969247683 4:5945978-5946000 CTGGAGAAAGGGAGGAGAGAAGG + Intronic
969275807 4:6135100-6135122 CTTGAGAATGGGAGAGGATGGGG - Intronic
970495177 4:16617833-16617855 CATGATAAATGGAGAGAAGGAGG + Intronic
970573361 4:17404297-17404319 AAGGAGAAAGGGAGAGAAGGAGG + Intergenic
970737862 4:19195760-19195782 CTGGAGAAATGGAGCACAGGGGG - Intergenic
970991267 4:22215988-22216010 TTGCTGAATTGGAGAGGAGGTGG + Intergenic
971264808 4:25088244-25088266 CTGGAGAGATGGAGGGGACAGGG - Intergenic
971342116 4:25780305-25780327 CCGGAGACATGGACAGGAGCAGG - Intronic
971375301 4:26051346-26051368 GGGGAGGAGTGGAGAGGAGGGGG - Intergenic
971725316 4:30304193-30304215 CAGGAGAAAGAGAGAGGCGGGGG + Intergenic
972209609 4:36821794-36821816 ATGGAGGAAAGGAGAGGAAGGGG + Intergenic
972308323 4:37853869-37853891 CTGCAGAAATGGAGAAGAGGTGG + Intronic
973058276 4:45687567-45687589 CTGAAGAAATTGACAAGAGGAGG + Intergenic
973151837 4:46897958-46897980 AAGGAGAAATGGAGAGGTGGAGG - Intronic
974112554 4:57542569-57542591 CTGGAGAACTAGAAAGGTGGTGG + Intergenic
977388104 4:96371066-96371088 CTACAGAAATGGGGAGGTGGTGG + Intergenic
977586391 4:98779762-98779784 CTGCACAAATGGAGGGGAGGAGG - Intergenic
977765123 4:100788526-100788548 CTGGAGATCTGGAGATGGGGAGG - Intronic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
978421856 4:108541787-108541809 CAGGAGCAAGGGAGAGAAGGGGG - Intergenic
978591432 4:110328813-110328835 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
979111443 4:116762260-116762282 CTTGAGAAAAGGAGAAGAGTGGG + Intergenic
979342196 4:119538665-119538687 CTGGAGAAATGGGGACCATGAGG - Intronic
980205358 4:129712526-129712548 TTGGAGATATGTTGAGGAGGAGG + Intergenic
980401393 4:132290599-132290621 CTGGAGAAATGGTGGGATGGGGG + Intergenic
981730021 4:147887329-147887351 CTGGAGCAGTGGAGAGAAGATGG - Intronic
981736750 4:147961655-147961677 CTGGAGAAGGGGAGAAGAGTGGG - Intronic
982209627 4:153023862-153023884 CGGGAGAAAGGGGGAAGAGGAGG - Intergenic
982223214 4:153142176-153142198 CCACAGAAATGAAGAGGAGGTGG + Intergenic
982424704 4:155245012-155245034 CTGGAGAAATTGAGTGATGGTGG + Intergenic
982435812 4:155383025-155383047 CTGCAGAGAGGGAGAGGAGGAGG - Intergenic
982445880 4:155490267-155490289 TTGGAGGAATGAAGAGGAGTTGG + Intergenic
982903447 4:161037882-161037904 CTGGAGAAATAGAGTGAAGGAGG + Intergenic
983007572 4:162503561-162503583 CTGGAGCAACGGGGTGGAGGGGG + Intergenic
983115537 4:163811544-163811566 ATAGAGAAACGGAGAGCAGGAGG + Intronic
983163788 4:164450127-164450149 ATGGAGAAATAGAGAGAAAGAGG + Intergenic
983238590 4:165207321-165207343 CTGGAAAATGGGAGCGGAGGGGG - Intronic
983281771 4:165690069-165690091 GTGGAGAAAGGGAGATTAGGAGG - Intergenic
983683135 4:170375090-170375112 CTACAGACATGGAGAGGTGGAGG - Intergenic
983750722 4:171266076-171266098 GAGGAGAAAAGAAGAGGAGGAGG - Intergenic
984123901 4:175781298-175781320 CTGAAGAAATGAAGGGAAGGGGG + Intronic
984709290 4:182871767-182871789 CTGGGGAAGTGGTGGGGAGGTGG - Intergenic
984841979 4:184077291-184077313 CCAGAGAAAAGGAGACGAGGAGG - Intergenic
985117431 4:186605544-186605566 GAGGAGGAATGGAGAAGAGGTGG + Intronic
985506092 5:281294-281316 CTGAAGACCTGGAGAGGAGCTGG + Intronic
986402286 5:7394259-7394281 CTGGAAACAAGGAGTGGAGGAGG - Intergenic
986507075 5:8463222-8463244 GTTGAGAAATTGGGAGGAGGAGG + Intergenic
987030633 5:13973559-13973581 TTTGTAAAATGGAGAGGAGGAGG + Intergenic
987777402 5:22385849-22385871 CAGGAGAAAGGGAGAGAAGGTGG + Intronic
987859233 5:23462846-23462868 TGGGAGAATTGGAGAGGAGATGG + Intergenic
987879531 5:23725030-23725052 AGGAAGAAATGGAGAGAAGGGGG - Intergenic
988065283 5:26224250-26224272 CTGGAGACCTGGGGAGGAGCTGG - Intergenic
988065451 5:26225459-26225481 CTGGAGAAATGGGGAGGAGCTGG - Intergenic
988065594 5:26226584-26226606 CTGGAGACCTGGGGAGGAGTGGG - Intergenic
988065711 5:26227567-26227589 CTGGAGACCTGGGGAGGAGCGGG - Intergenic
988153143 5:27413886-27413908 TTGGGGAAAGGAAGAGGAGGAGG - Intergenic
988420452 5:30999563-30999585 ATGGAGAAATGCAGAGGACTAGG - Intergenic
988617888 5:32793116-32793138 CTTGAGGAGTGGAGAGGAGGAGG + Intergenic
989517652 5:42362195-42362217 CTTGAGATATGAAGAGGATGGGG + Intergenic
990211533 5:53484929-53484951 CTAGAGAAAGGGAGAAAAGGGGG + Intronic
990468052 5:56087918-56087940 CTTGCGAGTTGGAGAGGAGGTGG + Intergenic
991137995 5:63205818-63205840 CTTGGAAAATGAAGAGGAGGTGG + Intergenic
991445724 5:66698313-66698335 GTTGAGACAAGGAGAGGAGGAGG - Intronic
991487968 5:67157621-67157643 CAGGAGAGATGGAGAGGACTGGG + Intronic
991538517 5:67700445-67700467 CTGGAGAGAGAGAGAGGAGAGGG - Intergenic
992180123 5:74187885-74187907 CTGGAGAAAGGGAGTGGGAGTGG + Intergenic
992420236 5:76596681-76596703 CAGGAGGAATAGAGAGAAGGGGG + Intronic
992837394 5:80654572-80654594 CTGCACAAATGGGGACGAGGGGG - Exonic
993468635 5:88279384-88279406 CAGGAGAAAAGGAGACGAGAAGG + Intergenic
993945042 5:94108731-94108753 GTGGAGAAATGGTGAGGATGTGG + Intronic
994133154 5:96254229-96254251 CTGGAGAAAGTAAGAGGAGTAGG - Intergenic
994221551 5:97201435-97201457 CAGGAGGAAGGGAGAGAAGGGGG + Intergenic
995606981 5:113867447-113867469 CTGGAGAAACTGGGAGAAGGTGG - Intergenic
995688805 5:114800421-114800443 AGGGAGAAAGGGAGAGAAGGAGG + Intergenic
997456030 5:134018243-134018265 CAGGAGCAAGGGAGAGAAGGAGG + Intergenic
997523615 5:134538822-134538844 TTGGAGAGATGGAGAGATGGAGG + Intronic
997924100 5:138012109-138012131 CTTATGAAATGGAGAAGAGGTGG + Intronic
998105846 5:139468675-139468697 CCAGAGAGATGGAAAGGAGGTGG + Intergenic
998130551 5:139649273-139649295 CTGGAGTAGTGGGGGGGAGGGGG - Intronic
998188938 5:140005818-140005840 TTGGGGAAATGCATAGGAGGGGG + Intronic
998287744 5:140879880-140879902 AGAGAGACATGGAGAGGAGGAGG - Intronic
998507734 5:142685621-142685643 CTGGAGGAATGGAGATAATGTGG + Intronic
998661918 5:144248174-144248196 CTTGAGAAAGGGAGAGTAGGGGG + Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999071411 5:148747504-148747526 GGGGAGAATTGGAGAGTAGGGGG + Intergenic
999499686 5:152134361-152134383 CTTAAGAGATGGACAGGAGGTGG + Intergenic
999562569 5:152820569-152820591 CTAGAGCAAAGAAGAGGAGGAGG + Intergenic
999763658 5:154722219-154722241 CTGGAAAAAGGGAGAGGGCGGGG - Intronic
1000090028 5:157922257-157922279 CTGGCGAAAGGGATAGGAAGGGG + Intergenic
1000120631 5:158194647-158194669 CTGGAGGGAGGGAGAGGAGGAGG - Intergenic
1000193754 5:158938340-158938362 CTGGAGCAGAGGAGGGGAGGAGG - Intronic
1000411215 5:160936498-160936520 CTGGAGAATTGTAGAGGCTGTGG + Intergenic
1000881799 5:166706399-166706421 CAGGAGAAATAGTGAGGAAGGGG + Intergenic
1001322823 5:170697057-170697079 CGAGAGAGAGGGAGAGGAGGAGG - Intronic
1001323787 5:170704661-170704683 CTGGAGAAAGCAGGAGGAGGAGG - Intronic
1001397941 5:171429889-171429911 CTGGAAAAGTAGAAAGGAGGTGG + Intronic
1001413734 5:171528717-171528739 CTGGATAAATGGTGGTGAGGAGG + Intergenic
1001727760 5:173921423-173921445 CAGAGGAAATGGTGAGGAGGAGG + Intronic
1002161051 5:177314362-177314384 CTGAAGACATGGCCAGGAGGTGG + Intergenic
1002504412 5:179669023-179669045 CTGGAGGCAATGAGAGGAGGTGG + Intergenic
1002620309 5:180483511-180483533 CTGAAGAGATGCAGAGGATGTGG - Intergenic
1002968789 6:1993127-1993149 CTGGGGCAAGGGAGAGGAGATGG - Intronic
1003039420 6:2673495-2673517 CTCAGGAAATGGAGAGGATGAGG + Intronic
1003271583 6:4612438-4612460 CTGGAGCAATGGTGAGCATGAGG + Intergenic
1003576074 6:7296643-7296665 CTGGAGGGAAGGAAAGGAGGAGG + Intronic
1004442594 6:15668207-15668229 CTGAAGAACAGGAGAGAAGGGGG + Intergenic
1004566715 6:16804795-16804817 ACGGAGAAATGAAGGGGAGGAGG + Intergenic
1005414668 6:25587030-25587052 CTGGGGAAAGGGAGAGGGAGGGG + Intronic
1005842910 6:29755981-29756003 CGCAAGAAATGGGGAGGAGGAGG - Intergenic
1006141874 6:31934143-31934165 CTGGAGAAATGTGGAAGGGGAGG - Intronic
1006183156 6:32166082-32166104 CTGGAGAAATTAATAGGAGAGGG + Intronic
1006308416 6:33239519-33239541 CTGGAGGAATGCAGAGGAAACGG + Intergenic
1006748607 6:36362679-36362701 CTGGGGAGATGGAGAAAAGGTGG + Intronic
1007095424 6:39209893-39209915 CTTGAGAATTGATGAGGAGGTGG - Intronic
1007518108 6:42429452-42429474 CCGGAGAAAGTGAGAGGAGGCGG - Intronic
1007727718 6:43926742-43926764 CCGGGGAAATGGAAAGCAGGAGG + Intergenic
1008367425 6:50698735-50698757 CTGGAGGGGTGGAGAGGTGGGGG + Intergenic
1008515470 6:52314691-52314713 CTGGATAGATGGAAAGGAGGAGG + Intergenic
1008798476 6:55337138-55337160 GAGGAGAAATGGAGAGAAGTTGG - Intronic
1009684373 6:66937014-66937036 CAGGAGAAATGGACCGGAGTGGG + Intergenic
1009781732 6:68280089-68280111 CTTGAGAAATGGAGAGGGGAGGG + Intergenic
1009958453 6:70486955-70486977 CTGCAGAAATAGAGAAGAGATGG + Intronic
1010971928 6:82272074-82272096 AGGGAGGAATGGAGAGGCGGAGG + Intergenic
1011084232 6:83521512-83521534 CTGTCGAAGAGGAGAGGAGGGGG - Intronic
1011206717 6:84906880-84906902 CTGCTGAAATGAAGAGGAAGAGG + Intergenic
1011213625 6:84981328-84981350 CTGGAGAAATGCAGAGGATGAGG + Intergenic
1011718087 6:90128033-90128055 CTGGGGAAATGGAGATGGGGGGG - Intronic
1012008565 6:93749770-93749792 TTGGATAAATAGAGAGGAAGAGG + Intergenic
1013705775 6:112832321-112832343 CTGAAGAAAGGCAGAGGAGGGGG + Intergenic
1014466077 6:121758801-121758823 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1014684407 6:124477802-124477824 AGAGAGAGATGGAGAGGAGGGGG - Intronic
1015051825 6:128850281-128850303 CTGGAGTAGTCGAGAGGAGGAGG - Intergenic
1015342610 6:132119010-132119032 TAGGAGAAATGGAGAGGATTAGG + Intergenic
1015387942 6:132647511-132647533 AGGGAGGAAAGGAGAGGAGGAGG + Intergenic
1015389927 6:132670123-132670145 GAGGGGAAAAGGAGAGGAGGAGG + Intergenic
1016136004 6:140543988-140544010 CTGGAGAAAGAGAGAGAAGTGGG - Intergenic
1016279725 6:142401729-142401751 GTGGAGAAATGGAGAGAATTTGG + Intronic
1016434322 6:144020097-144020119 GTGGAGAGAGGGAGAGAAGGAGG - Intronic
1016589366 6:145728009-145728031 CAGGAGGAATAGAGAGAAGGGGG - Intronic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1016986416 6:149899028-149899050 TTGGAGAATTGGAGCAGAGGGGG - Intergenic
1017009615 6:150054404-150054426 CTGGAGACCTGGTGAGGAGCTGG - Intergenic
1017009642 6:150054608-150054630 CTGGAGACCTGGGGAGGAGCTGG - Intergenic
1017132396 6:151118864-151118886 CTGGAAAAATGGGGTGGGGGTGG + Intergenic
1017715218 6:157206152-157206174 CCAGACAACTGGAGAGGAGGAGG - Exonic
1018283793 6:162216092-162216114 ATGGACAAATGGACAGGATGGGG + Intronic
1018537472 6:164836701-164836723 CTGGAGGCATGGACAGGAGGTGG - Intergenic
1018849966 6:167579834-167579856 CTGGAGAGACAAAGAGGAGGGGG + Intergenic
1018988826 6:168658097-168658119 ATGGGGAGATGGAGAGCAGGTGG + Intronic
1018998257 6:168726422-168726444 CTGGTGGATGGGAGAGGAGGAGG + Intergenic
1019102291 6:169641225-169641247 CTGGAGCTCGGGAGAGGAGGGGG - Intronic
1019419302 7:943245-943267 GAGGAGGAAGGGAGAGGAGGAGG + Intronic
1019694328 7:2436734-2436756 ATGCAGAAATGGAGGGGACGCGG - Intergenic
1019770376 7:2880627-2880649 CTGGAGAAACTGAGGGGCGGGGG - Intergenic
1020080203 7:5282752-5282774 GAGGAGGAATGGGGAGGAGGGGG + Intronic
1020431822 7:8123258-8123280 CTGGGGAAATGGAGAGGAAGGGG - Intronic
1020469681 7:8521874-8521896 ATGGAGATTTGGATAGGAGGAGG + Intronic
1021206274 7:17785198-17785220 CAGGAGCAAGAGAGAGGAGGGGG + Intergenic
1021488213 7:21190004-21190026 CTGCAGAAATCTAGAGGTGGGGG + Intergenic
1022298609 7:29081367-29081389 GGGCAGAAATGAAGAGGAGGAGG + Intronic
1022389226 7:29928954-29928976 ATGGAGCAGTGGGGAGGAGGAGG + Intronic
1022404824 7:30078892-30078914 CTGGGGGGATGGACAGGAGGTGG + Exonic
1022972792 7:35532566-35532588 AAGGAGGAATGGAAAGGAGGTGG + Intergenic
1023569520 7:41557490-41557512 CTGGGGAGATGGGGAGGGGGAGG + Intergenic
1023602441 7:41892959-41892981 CTGGAGAAATGAGAAGGAAGGGG + Intergenic
1023684595 7:42721409-42721431 CTGGAGAACAAGAGAGGAGCCGG + Intergenic
1024360746 7:48464885-48464907 CAGGACAAATGGAGCAGAGGAGG + Intronic
1024402326 7:48939269-48939291 AGGGAGAAAGAGAGAGGAGGAGG + Intergenic
1024505169 7:50156626-50156648 CCTGGGATATGGAGAGGAGGAGG - Intronic
1024676345 7:51641162-51641184 CCTGAGAAACAGAGAGGAGGAGG + Intergenic
1025233353 7:57217651-57217673 CTGAAGAACCAGAGAGGAGGCGG + Intergenic
1025233906 7:57220790-57220812 CTGGAGAACCAGAGAGGAGCCGG + Intergenic
1025233943 7:57221001-57221023 CTGGAGACCTGGACAGGAGCTGG + Intergenic
1025233977 7:57221215-57221237 CTGGAGACCTGGGGAGGAGCTGG + Intergenic
1025932926 7:66010842-66010864 CTGGAGACAGAGAGAGGAGAAGG + Intergenic
1025950457 7:66141411-66141433 CTGGAGACAGAGAGAGGAGAAGG - Intronic
1025976781 7:66376729-66376751 CTGGAGAGCTGGACTGGAGGAGG + Intronic
1026045697 7:66904182-66904204 CTGGAGAGCTGGACCGGAGGAGG - Intergenic
1026399803 7:69998166-69998188 CTGTAGAAATGGTGATGATGTGG + Intronic
1026500999 7:70943358-70943380 CTGGAGAAATGTGGAAGATGGGG - Intergenic
1026679025 7:72451321-72451343 CAGGAGAAAGAAAGAGGAGGAGG + Intergenic
1026736977 7:72954934-72954956 CTGAAGAACTGGAGAAGAAGTGG - Intergenic
1027106755 7:75410129-75410151 CTGAAGAACTGGAGAAGAAGTGG + Intronic
1027138211 7:75639232-75639254 CCGGAGAAAGGAAGGGGAGGGGG + Intronic
1027228250 7:76258272-76258294 CTGGAGGAAAGGAGGGGAAGCGG + Intronic
1027306339 7:76901843-76901865 CACTAAAAATGGAGAGGAGGAGG + Intergenic
1028292088 7:89077214-89077236 CTGGAGAAATTCAGAAGTGGAGG + Intronic
1028931054 7:96413710-96413732 GTGGAGAAGGGGAGAGGAGGTGG - Intergenic
1029159123 7:98539203-98539225 CTGGAGTATTGGAGAGTAAGTGG - Intergenic
1029484128 7:100828891-100828913 CTGGATAGATGGATTGGAGGGGG + Intronic
1030078049 7:105753619-105753641 CTGCTGTAATGGAGAGGAGAGGG - Intronic
1030345749 7:108431240-108431262 CTGGACAAAGAGACAGGAGGAGG - Intronic
1031122885 7:117741203-117741225 ATGGGGGAATGGAGAGCAGGAGG + Intronic
1031362535 7:120864273-120864295 CTGCCGAAATGGAGATGAGCTGG + Intergenic
1031529209 7:122855873-122855895 CTGGAGGAAAAGAGAGGAGAAGG - Intronic
1031844307 7:126785815-126785837 CTGGTAAAATCTAGAGGAGGTGG - Intronic
1032552039 7:132793101-132793123 CAGGAGAAATGGAAAGGAGCGGG - Intronic
1032689124 7:134265123-134265145 CTGGAGAAGTGGGGAGGAAGAGG + Intergenic
1032732815 7:134660602-134660624 CTGGAGGGCTGGGGAGGAGGAGG + Intronic
1033078990 7:138277003-138277025 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
1033854192 7:145536916-145536938 CTGGAGACTGGGAGAGGAGATGG + Intergenic
1033920517 7:146386231-146386253 TGGGACAAATGGAGGGGAGGAGG - Intronic
1034010427 7:147523617-147523639 CTGCAGAAGCAGAGAGGAGGAGG - Intronic
1034621930 7:152463580-152463602 ATGGAAAAAAGGAGAGGAAGAGG + Intergenic
1034735559 7:153426183-153426205 GTGAGAAAATGGAGAGGAGGTGG + Intergenic
1034892103 7:154850185-154850207 TTGGAGGAAAGGGGAGGAGGGGG - Intronic
1034947989 7:155276351-155276373 CAGGGAAAAGGGAGAGGAGGCGG + Intergenic
1034993100 7:155560358-155560380 CTGGAGGAGTGGGGAAGAGGAGG + Intergenic
1035061151 7:156070633-156070655 CTGCAGGAAGGGAGGGGAGGCGG - Intergenic
1035120274 7:156560938-156560960 CCGGAGCCATGGGGAGGAGGGGG + Intergenic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1035704285 8:1663282-1663304 CTGAAGAAATGAAGGGGTGGTGG + Intronic
1035987335 8:4449343-4449365 CTGGAAAAAAAGAGAGGGGGAGG - Intronic
1036120027 8:6006216-6006238 CAGGAGGAAGAGAGAGGAGGGGG + Intergenic
1036407213 8:8465880-8465902 CTGCATAAATGGGGAGAAGGAGG + Intergenic
1036614906 8:10380720-10380742 CTGGAGAGATGGATGGAAGGAGG + Intronic
1037182112 8:16019801-16019823 AAGGACAAATGAAGAGGAGGAGG - Intergenic
1037622272 8:20575010-20575032 CTGCAGACATTCAGAGGAGGAGG + Intergenic
1037709223 8:21342346-21342368 CTGGAGGGATGGAGGGGTGGAGG + Intergenic
1038528298 8:28295993-28296015 CTTGAGGAATGGAGGGGAGTAGG - Intergenic
1038722239 8:30047311-30047333 ATGGAGAAAGGGAGAGGAGGCGG - Intergenic
1039671202 8:39601070-39601092 CAGGAGGAAGAGAGAGGAGGAGG + Intronic
1039788934 8:40858764-40858786 GTGGAGAAGAGGAGAGGAGTAGG - Intronic
1039903878 8:41772430-41772452 GAGAAGAAATGGAGGGGAGGAGG - Intronic
1039964976 8:42277632-42277654 CTGGAGGAATGTGGAGGAGGGGG - Intronic
1040724915 8:50370692-50370714 CTGGAAGAAAGGAGCGGAGGTGG - Intronic
1041312872 8:56534211-56534233 CTGGAGAGAGGGGGAGGATGAGG + Intergenic
1041750946 8:61260514-61260536 ATGGAGAGGTGGAGAGGAGATGG - Intronic
1042389107 8:68212427-68212449 CTGGAGTAATGGAGACTTGGGGG + Intronic
1042482701 8:69322270-69322292 CTGGAGACTTGGGGAGGAGCTGG + Intergenic
1042482790 8:69322958-69322980 CTGGAGACCTGGGGAGGAGTGGG + Intergenic
1042482840 8:69323397-69323419 CTGGAGACCTGGGGAGGAGCAGG + Intergenic
1042483218 8:69325901-69325923 CTGGAGACCTGGGGAGGAGCTGG + Intergenic
1043085423 8:75826171-75826193 CAGGAGAAACAGAGAGTAGGGGG - Intergenic
1043423949 8:80130142-80130164 CTGCTGAGATGAAGAGGAGGTGG + Intronic
1044557298 8:93577425-93577447 CTGTACAAATGGAGAGAAGTGGG + Intergenic
1044666827 8:94640806-94640828 CTGGATGAATGGAGAGGCGAGGG - Intergenic
1044693410 8:94900232-94900254 TGGGATAAATGGAGGGGAGGGGG + Intronic
1044720359 8:95139711-95139733 CTGGAGAAAGGGGGTGGAGGGGG - Intronic
1045065734 8:98442249-98442271 TTGGAGAATTGGAGAGGGGAAGG - Intronic
1046023092 8:108689868-108689890 CTGGAGAAATGGAGAGGAGGGGG - Intronic
1046453879 8:114433166-114433188 CTGGAGAAATGGAAAAGCTGGGG - Intergenic
1047464595 8:125100010-125100032 GTGGATAATTGGAGTGGAGGTGG + Intronic
1047598921 8:126407181-126407203 CTGCAGGAATGCAGAGGAAGGGG + Intergenic
1047647755 8:126886703-126886725 AAGGAGAAAGAGAGAGGAGGAGG - Intergenic
1047745274 8:127840263-127840285 CCTGAGAAAGGGAGAGGAAGGGG - Intergenic
1047801625 8:128316078-128316100 CTGGAGGTAAGGAGAGCAGGAGG + Intergenic
1048163035 8:132038356-132038378 GGGGAGGAAGGGAGAGGAGGAGG + Intronic
1048219050 8:132524792-132524814 CTGGAGGGATGAAGAGGAGGCGG - Intergenic
1048284450 8:133130915-133130937 CTGGAGGAAGAAAGAGGAGGGGG + Intronic
1048348286 8:133595130-133595152 CTGGAGAGAGAGAGAGAAGGAGG + Intergenic
1049211618 8:141389212-141389234 CTGGAGGCATGGCCAGGAGGAGG - Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049469258 8:142768199-142768221 GAGGAGGAATAGAGAGGAGGAGG + Intronic
1049584867 8:143428305-143428327 CGGGAGAGAGGGCGAGGAGGCGG - Exonic
1049595948 8:143483426-143483448 CTGGGGCAATGCAGGGGAGGTGG + Intronic
1049750017 8:144278601-144278623 CTGGAGACGTGGACAGCAGGAGG + Intronic
1049940831 9:544744-544766 TTGGGGAAGAGGAGAGGAGGGGG + Intronic
1050589895 9:7150029-7150051 CTGTAGAAAGGGAGAGGAAGGGG + Intergenic
1051896968 9:21996816-21996838 CTGGAGGAATGGAGTGGGAGCGG + Intronic
1052091192 9:24329785-24329807 TTCCAGAAAAGGAGAGGAGGAGG - Intergenic
1052370984 9:27664219-27664241 CTGGAGAATTGAGGAGGAGGGGG - Intergenic
1052508589 9:29384905-29384927 CTGGAGAGGTGGAGAGGATGTGG + Intergenic
1052819855 9:33129880-33129902 CCAGTGAAGTGGAGAGGAGGAGG + Intronic
1054818408 9:69497691-69497713 CTGTGGAAATGGAAAAGAGGAGG - Intronic
1054892372 9:70265122-70265144 CTTGAGAAAGGAGGAGGAGGAGG + Intronic
1055084167 9:72297266-72297288 CAGGAAAAACTGAGAGGAGGAGG - Intergenic
1055123779 9:72694675-72694697 CAAGAGAAAAAGAGAGGAGGAGG + Exonic
1055397257 9:75889229-75889251 CTGGAGAAAGGGGAAGGGGGAGG - Intergenic
1055981252 9:82003800-82003822 CTGGAAAAAGAGAGAAGAGGGGG - Intergenic
1055988262 9:82076624-82076646 CTGGAGAAAGGGTTTGGAGGGGG - Intergenic
1056067978 9:82956684-82956706 GTGGGGATCTGGAGAGGAGGTGG + Intergenic
1056240105 9:84636747-84636769 GAGGAGAAAAGAAGAGGAGGAGG - Intergenic
1056369602 9:85941106-85941128 CGGGAGTAAGGGAGAGGGGGCGG + Intergenic
1056387815 9:86113511-86113533 ATGGAGAAATGGTGTGGAGTTGG + Intergenic
1057267766 9:93630367-93630389 CTGGATAAATGGTGATGCGGGGG + Intronic
1057307603 9:93921213-93921235 CTGGGGAACTGGAGAGCTGGGGG + Intergenic
1057821054 9:98331452-98331474 CTGTGGAAACGCAGAGGAGGTGG - Intronic
1057928130 9:99170808-99170830 AGGGAGGGATGGAGAGGAGGGGG + Intergenic
1058139523 9:101342558-101342580 AGGGAGAGATGGGGAGGAGGAGG + Intergenic
1058170471 9:101674427-101674449 TAGCAGAAATGGAGAGGAGATGG + Intronic
1059070583 9:111131821-111131843 CAGCAGAAGTGGAGAGGAGGAGG + Intergenic
1059228516 9:112695759-112695781 TAGGAGGAAGGGAGAGGAGGAGG + Intronic
1059322662 9:113481591-113481613 CAGGACAAATGGAGTGGTGGAGG - Intronic
1059355560 9:113696852-113696874 AAGGAGAAATAGAGAGAAGGGGG - Intergenic
1059657349 9:116368679-116368701 CTGGAGAAACCGAAAGAAGGAGG + Intronic
1059763353 9:117360502-117360524 CTGGGGATATGGAGATGAGCAGG + Intronic
1060100426 9:120835778-120835800 CTGGAGGAACGGGGAAGAGGAGG + Intronic
1060479852 9:124011755-124011777 CGGGAGAATTGAAGAGGAGGAGG - Exonic
1060497144 9:124127054-124127076 CTGGAGGGCTGGAGAGGATGCGG + Intergenic
1060834037 9:126741458-126741480 TGGGAGACATGGAGAGGGGGTGG + Intergenic
1061257321 9:129460355-129460377 GGGGAAAGATGGAGAGGAGGAGG - Intergenic
1061271281 9:129544840-129544862 CTGGGGAGGTGGAGAGTAGGAGG - Intergenic
1061433045 9:130543307-130543329 CTGGGGACATGCAGAGGAGGGGG - Intergenic
1061750335 9:132772688-132772710 CTGGAGGAATGGGGTTGAGGAGG - Intronic
1061921533 9:133785159-133785181 CTGGTGAAATGGAGAGGGGAAGG - Intronic
1061947441 9:133916576-133916598 ATGGAGAAGGGGAAAGGAGGGGG + Intronic
1062340971 9:136093924-136093946 CTGGAGAACAGGAGGGAAGGAGG + Intronic
1062448038 9:136603972-136603994 CTGGGGATGAGGAGAGGAGGAGG + Intergenic
1062486288 9:136778035-136778057 CTGGAGACTTGGAGAGGAGCTGG - Intergenic
1062486293 9:136778085-136778107 CTGGAGAACTGAGGAGGAGCTGG - Intergenic
1062486349 9:136778387-136778409 CTGGAGACCTGGGGAGGAGATGG - Intergenic
1203732255 Un_GL000216v2:101191-101213 CTGTAGCTAAGGAGAGGAGGAGG + Intergenic
1203736324 Un_GL000216v2:142919-142941 CCGGAGAAACGAAGAGGAAGGGG - Intergenic
1203457978 Un_GL000220v1:8002-8024 CTGGAAACATGGAGGGGCGGAGG - Intergenic
1203349674 Un_KI270442v1:69481-69503 GTGGTGAAGTGGAGTGGAGGGGG + Intergenic
1185688239 X:1948184-1948206 GAAGAGAAAAGGAGAGGAGGAGG + Intergenic
1185688528 X:2133723-2133745 GAAGAGAAAAGGAGAGGAGGAGG + Intergenic
1185697571 X:2206726-2206748 CTGGAGTATTTGGGAGGAGGTGG - Intergenic
1185724926 X:2411958-2411980 CTGGAGGAATGGAGAAGGTGAGG + Intronic
1185831098 X:3303767-3303789 CAGGAGACACGGAGAGGAGTAGG + Intergenic
1185926518 X:4153139-4153161 CTGGAGAAAGAGAGATGGGGAGG + Intergenic
1187173079 X:16870352-16870374 CTGGGAAAAGTGAGAGGAGGCGG + Intronic
1187526231 X:20057637-20057659 GTGGAGATAGGGAGAGGAGTTGG - Intronic
1187984662 X:24797217-24797239 CAGGGGAAATGGAGAGAGGGTGG - Intronic
1189266732 X:39722501-39722523 GAGGAGAAATGAAAAGGAGGAGG - Intergenic
1189354107 X:40298581-40298603 CTGGGCAGATGGAGAGGGGGAGG - Intergenic
1189369717 X:40417989-40418011 CTGGAGATATGGACATGAAGAGG - Intergenic
1189455466 X:41184374-41184396 CTGGAAAAATAGAGAAGAGGGGG - Intronic
1190005535 X:46733100-46733122 AAGGAGAAATGGAGAGTTGGGGG + Intronic
1190256280 X:48765108-48765130 CTGCAGAATGGGAAAGGAGGGGG + Intronic
1190310094 X:49111099-49111121 CTGCAGACATGGAGATGAAGAGG + Intergenic
1190534175 X:51409101-51409123 CTGGAGAAAAGGAGGGGTGATGG + Intergenic
1190576822 X:51847743-51847765 CAGGAGAAAGAGATAGGAGGAGG - Intronic
1190789559 X:53686369-53686391 CTGGGGGAGGGGAGAGGAGGCGG + Intronic
1191023856 X:55892453-55892475 CAGGAGAAAGGGAAAGAAGGAGG + Intergenic
1191676278 X:63795326-63795348 GAGGAGAAAAGAAGAGGAGGAGG + Intergenic
1191700058 X:64032890-64032912 CTGGAGGAATAGAGTGGTGGAGG - Intergenic
1191779048 X:64847269-64847291 CTGGAGTAATGAGGAGGAGAGGG - Intergenic
1191850567 X:65582923-65582945 TTGGAGAAAGGGAGAGCAGGAGG + Intergenic
1192550560 X:72050057-72050079 CTGGAGGGAGAGAGAGGAGGAGG - Intergenic
1193743960 X:85252645-85252667 TTTCAGAAATGGGGAGGAGGTGG - Intronic
1194418535 X:93643573-93643595 AGGGAGAAATAGAGAGGAGAAGG + Intergenic
1194470896 X:94295607-94295629 CTCAAGAAATGGAGAGAAGGAGG + Intergenic
1194748799 X:97660779-97660801 ATAGTGAAATGCAGAGGAGGTGG - Intergenic
1195077149 X:101338096-101338118 AAGCAGAAATGGAGAGAAGGAGG - Intergenic
1195130111 X:101842898-101842920 GTGGGGAAAGGGAGAGAAGGTGG + Intronic
1195352067 X:104005384-104005406 GGGGAGAAATGGAGAGGGGATGG - Intergenic
1195720766 X:107865695-107865717 CTTGGGATATGGAGAAGAGGAGG - Intronic
1196628295 X:117904494-117904516 CTGGAAAAATCTAGAGCAGGTGG + Intronic
1196754199 X:119143595-119143617 CTGGAGAAGAGGAAAGGGGGAGG - Intronic
1196828414 X:119758519-119758541 AGGGAGCAAAGGAGAGGAGGAGG - Intergenic
1196887574 X:120262638-120262660 CAGGAGGGAGGGAGAGGAGGAGG - Intronic
1197668520 X:129249519-129249541 CTAGAGGAATGCAGAGAAGGAGG + Intergenic
1197836804 X:130703353-130703375 CTGGAGAAATGGACAAGTGGTGG + Intronic
1197934035 X:131722300-131722322 CAGGACAACTGGAGAGGAGGCGG - Intergenic
1198116729 X:133551436-133551458 ATAGAGAAATGGAAAGGAGGGGG - Intronic
1198279153 X:135125078-135125100 TGGGAGACCTGGAGAGGAGGAGG - Intergenic
1198291804 X:135247442-135247464 TGGGAGACCTGGAGAGGAGGAGG + Intergenic
1198297834 X:135304377-135304399 TGGGAGACCTGGAGAGGAGGAGG + Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198576524 X:138016166-138016188 ATGGGGATATGAAGAGGAGGAGG - Intergenic
1199126105 X:144122498-144122520 CAGGAGAAAGAGAGACGAGGGGG + Intergenic
1199496401 X:148457425-148457447 CTGGAGAAGTGGAGACCAAGTGG - Intergenic
1199507916 X:148586925-148586947 AGGGAGAAAAGAAGAGGAGGAGG - Intronic
1199548362 X:149031979-149032001 AGGGAGAAATGGGGAGGGGGTGG + Intergenic
1199599887 X:149535575-149535597 GAGGAGAAAAGGAGAGGAGAGGG - Intergenic
1199650753 X:149944676-149944698 GAGGAGAAAAGGAGAGGAGAGGG + Intergenic
1199855540 X:151756203-151756225 CAGAAGAAAGGGCGAGGAGGAGG - Intergenic
1200292302 X:154885644-154885666 CTGGAGGGATGGAGAGGTGGTGG + Intronic
1200339139 X:155381381-155381403 CTGGAGGGATGGAGAGGTGGTGG + Intergenic
1200347330 X:155459311-155459333 CTGGAGGGATGGAGAGGTGGTGG - Intergenic
1200399546 X:156011030-156011052 CTGGAGCAAGGGGGAGGATGAGG - Intergenic
1201176770 Y:11314606-11314628 CTGGAGAAATGAAGAGGAAGGGG - Intergenic
1201310734 Y:12596385-12596407 CCGGACTAATGGAGAGGAGCAGG + Intergenic
1202377489 Y:24250517-24250539 CTGGAGAAAAGGAGGGGGAGAGG + Intergenic
1202493292 Y:25419605-25419627 CTGGAGAAAAGGAGGGGGAGAGG - Intergenic
1202628683 Y:56886367-56886389 CTGTAGCTAAGGAGAGGAGGAGG - Intergenic