ID: 1046027355

View in Genome Browser
Species Human (GRCh38)
Location 8:108740903-108740925
Sequence GTTTGTATTGGAAGAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046027353_1046027355 13 Left 1046027353 8:108740867-108740889 CCTAAAACTATGTGCAAAATAGT 0: 1
1: 0
2: 2
3: 25
4: 328
Right 1046027355 8:108740903-108740925 GTTTGTATTGGAAGAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046027355 Original CRISPR GTTTGTATTGGAAGAAAAGC TGG Intronic
No off target data available for this crispr