ID: 1046028749

View in Genome Browser
Species Human (GRCh38)
Location 8:108757173-108757195
Sequence GTGTTTTAGACCCCAAATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046028749_1046028755 30 Left 1046028749 8:108757173-108757195 CCCCAATTTGGGGTCTAAAACAC No data
Right 1046028755 8:108757226-108757248 AAGAACAGTAATGCTAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046028749 Original CRISPR GTGTTTTAGACCCCAAATTG GGG (reversed) Intronic