ID: 1046028749 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:108757173-108757195 |
| Sequence | GTGTTTTAGACCCCAAATTG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1046028749_1046028755 | 30 | Left | 1046028749 | 8:108757173-108757195 | CCCCAATTTGGGGTCTAAAACAC | No data | ||
| Right | 1046028755 | 8:108757226-108757248 | AAGAACAGTAATGCTAGATTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1046028749 | Original CRISPR | GTGTTTTAGACCCCAAATTG GGG (reversed) | Intronic | ||