ID: 1046029204

View in Genome Browser
Species Human (GRCh38)
Location 8:108763189-108763211
Sequence GTTACAATGGGGAAAAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046029204 Original CRISPR GTTACAATGGGGAAAAGGGT TGG (reversed) Intronic
901831301 1:11894195-11894217 GATATAATGGGGGAAAGGGAGGG + Intergenic
907827682 1:58034796-58034818 TTTAGAAGGGGGAAGAGGGTAGG - Intronic
908768980 1:67578906-67578928 GTCACACTGGGGCAAAAGGTGGG + Intergenic
908928893 1:69291828-69291850 CTTTCAAAGGGGCAAAGGGTTGG + Intergenic
909445739 1:75746231-75746253 GATCCAATGGGGAAAAGAGTGGG - Intronic
909698590 1:78494429-78494451 GTAACAATGGGGAAGTGGGAGGG + Intronic
910704544 1:90113895-90113917 GATATAATGGTGAAAAGGATGGG - Intergenic
912544131 1:110438805-110438827 TTTACAGTGGGAAAAAGGGAAGG + Intergenic
913091441 1:115479141-115479163 GTGAAAGGGGGGAAAAGGGTGGG + Intergenic
913246439 1:116874377-116874399 ATTAAACTGGGGCAAAGGGTGGG - Intergenic
915619441 1:157071351-157071373 GTTGCTATGGGGGAAAGGGGAGG - Intergenic
917355670 1:174124358-174124380 AAGACAATGGGGAAAAGGGCTGG + Intergenic
920030068 1:203031947-203031969 GTTAGAGTGTGGAAAATGGTTGG + Intronic
924203143 1:241681273-241681295 GGGACTCTGGGGAAAAGGGTGGG - Intronic
1063213002 10:3898466-3898488 GTAACAATGGTGCATAGGGTGGG - Intergenic
1064029522 10:11875051-11875073 GTTGCCATGGTGAAAAGCGTGGG - Intergenic
1067717276 10:48699197-48699219 GTGACCATGGAGAAGAGGGTGGG + Intronic
1067957285 10:50806276-50806298 GTCACAAAGAGGAAAAGGGAAGG - Exonic
1069395963 10:67988139-67988161 GTTACACTGGGAAGAAGGGCAGG + Intronic
1069473540 10:68713780-68713802 TTTACAGTGGGGAACAGAGTTGG + Intergenic
1071117453 10:82238587-82238609 TGGAGAATGGGGAAAAGGGTAGG - Intronic
1076380477 10:130021774-130021796 GTGACAACGGGGCAATGGGTGGG - Intergenic
1077132273 11:979012-979034 GACACCATGGGGAGAAGGGTTGG + Intronic
1078767699 11:14315166-14315188 AATACAATATGGAAAAGGGTTGG + Intronic
1079502586 11:21118284-21118306 TTTACAATGGGGAATATGGATGG + Intronic
1079999717 11:27333678-27333700 GTGCCAATGGGGAACAGGATGGG - Intronic
1081544438 11:44060020-44060042 GTTGCGATGGAGAAAATGGTGGG + Intergenic
1082630055 11:55531179-55531201 GTTACTATGGGAAAGAGGCTTGG + Intergenic
1082730849 11:56795734-56795756 GGACTAATGGGGAAAAGGGTGGG + Intergenic
1083550959 11:63589950-63589972 GTCACAGTTGGGACAAGGGTGGG - Intronic
1085273782 11:75285458-75285480 GTGACAATGGGTTAGAGGGTAGG - Intronic
1086269577 11:85045193-85045215 GTTGCAATTGAGAAAAGGGGAGG + Intronic
1087802610 11:102520109-102520131 GTTGGCATGGGGAAAAGGGAAGG + Intergenic
1087822993 11:102732225-102732247 GTCAAAATGGAGAACAGGGTGGG - Intergenic
1087985909 11:104679219-104679241 GTTACAATGCTGAAAAGAGGAGG + Intergenic
1089739064 11:120569649-120569671 GTGACTTTGGGGAGAAGGGTAGG + Intronic
1090047955 11:123352421-123352443 GTTCAAATTGGGAAAAGTGTTGG + Intergenic
1090481469 11:127072371-127072393 TTTACAATGGGGAAAAGGAAGGG + Intergenic
1090987274 11:131779830-131779852 GTAAGAATGGTGAAAAGGATGGG + Intronic
1091472209 12:738886-738908 TTGACAATGGGGAAAAGGTGGGG - Intergenic
1093706452 12:22279786-22279808 AACACAATGGGGAAAGGGGTTGG - Intronic
1096118327 12:49069461-49069483 GTTACTTTGGGGATAGGGGTGGG - Intronic
1096318623 12:50591374-50591396 AATACAATGGGGAAAAGATTAGG - Intronic
1099669653 12:85673985-85674007 GTTACACTGATGCAAAGGGTGGG + Intergenic
1100054140 12:90488915-90488937 GTTGCAATGGGAAAGAGGGATGG - Intergenic
1101542390 12:105676882-105676904 GTTACCAAAGGGAACAGGGTGGG + Intergenic
1102213877 12:111146516-111146538 ATGACAGTGGGGAAAGGGGTTGG + Intronic
1102491145 12:113290284-113290306 GTGACAAGGGTGACAAGGGTGGG - Intronic
1102599550 12:114019043-114019065 CTCACAATGGGGAATAGGGCAGG + Intergenic
1107967476 13:45610377-45610399 GATAGTTTGGGGAAAAGGGTTGG - Intronic
1109815378 13:67575464-67575486 ATTCCCATGGGGAAAAAGGTAGG + Intergenic
1110074887 13:71227872-71227894 GATTCATTGGGGAAAAGGATAGG - Intergenic
1110485762 13:76039708-76039730 GTTACTATGGTGATTAGGGTGGG + Intergenic
1111079822 13:83289356-83289378 TTTATAATGGGAAAAAGGGAAGG - Intergenic
1111217438 13:85163000-85163022 GACACACTGGTGAAAAGGGTGGG + Intergenic
1111714442 13:91862410-91862432 GTTAGCCTGGGGAATAGGGTGGG + Intronic
1112230388 13:97583818-97583840 GTTACAGTGGACAAAAGGGACGG + Intergenic
1112614089 13:100985620-100985642 TTTACAGTGGGCAAAAGGGATGG + Intergenic
1113969766 13:114180000-114180022 CTTCTAATGGGGACAAGGGTTGG - Intergenic
1117691372 14:58310948-58310970 TTTAAAATGGGCAAAAGGCTGGG + Intronic
1117773792 14:59161800-59161822 GGAACAAAAGGGAAAAGGGTGGG + Intergenic
1118338801 14:64878492-64878514 GTTATAGTGGGGGAAGGGGTGGG + Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1119614118 14:76087170-76087192 GAGTCAATGGGGAAAAGGGTAGG + Intergenic
1120170859 14:81246565-81246587 GTTACCATGGAGAAAGGGGCTGG + Intergenic
1123108909 14:105856181-105856203 GAGACGAGGGGGAAAAGGGTTGG + Intergenic
1124007144 15:25803354-25803376 GATACAGTGGGGCACAGGGTGGG + Intronic
1124381212 15:29168164-29168186 GATACAATGGGGAGAATAGTGGG + Intronic
1124445517 15:29728323-29728345 GTTACAGTGTGAAAAAGGGTGGG - Intronic
1126053640 15:44709939-44709961 TTTAAAAGGGGGAAAAGGGAGGG + Intronic
1126662874 15:51049339-51049361 GTTTCAAAGCTGAAAAGGGTGGG + Intergenic
1128486332 15:68093680-68093702 GTTATAATGGGGGGAAGGATTGG + Intronic
1129091178 15:73152493-73152515 GATACAATGAGGAAATGTGTAGG - Intronic
1131548520 15:93336092-93336114 GTTAAAGTTGGGCAAAGGGTTGG - Intergenic
1138090176 16:54167539-54167561 GTCACAGTGGAGAGAAGGGTTGG + Intergenic
1140280215 16:73546944-73546966 TTAACAATGGGGACAGGGGTAGG - Intergenic
1141503967 16:84462733-84462755 AGCACACTGGGGAAAAGGGTGGG - Intronic
1142675699 17:1511900-1511922 GTTAGACTGGGAGAAAGGGTGGG + Intronic
1142919780 17:3174243-3174265 TTTTCAGTGGAGAAAAGGGTAGG + Intergenic
1144157508 17:12520700-12520722 CTTAAAATGGGAAAAAGTGTTGG + Intergenic
1144461610 17:15463188-15463210 GAAACAATGGGGAAGTGGGTAGG + Intronic
1145075320 17:19850089-19850111 TTTACAATGGGGAAAAAGGAAGG + Intronic
1146570828 17:33951082-33951104 TTTACAATGGAGAAAATGGATGG - Intronic
1149613524 17:57977083-57977105 GTTAGAATGGGGAGAGGGGACGG - Intronic
1151982510 17:77521825-77521847 GTTACAAAGGTGAAAAAGCTAGG + Intergenic
1153725990 18:7955624-7955646 TTAACAATAGGAAAAAGGGTGGG - Intronic
1155794309 18:30015488-30015510 TTTACAATGAGGAAAAGTGCAGG + Intergenic
1156733190 18:40221321-40221343 GTTAGAGTGGGGAAAAAAGTGGG + Intergenic
1157497751 18:48168379-48168401 GTTATAAGGGGGAAAAGTGGTGG + Intronic
1158196361 18:54889745-54889767 GTCACATTGAAGAAAAGGGTAGG + Exonic
1159659370 18:71075090-71075112 GTTACACTGTGGCAAAGGGTGGG + Intergenic
1161675989 19:5649958-5649980 TTTCCAAAGAGGAAAAGGGTAGG + Exonic
1161940092 19:7396830-7396852 TTTAAAATGGGAATAAGGGTTGG + Intronic
1163521169 19:17792926-17792948 CTTACACATGGGAAAAGGGTGGG + Intergenic
1165057246 19:33185570-33185592 ATTACAAAGGGGGAAAGGGCTGG - Intronic
1166379438 19:42348168-42348190 GGTAAAATGGGGAAGAAGGTTGG + Intronic
1167323320 19:48809689-48809711 GTTATAATGGGGAAAAGTGCTGG - Intronic
1167663412 19:50810012-50810034 GTTAGAATGGGAAATAGGATTGG + Intergenic
925417848 2:3684568-3684590 GATACAATGTGGGGAAGGGTGGG - Intronic
927440656 2:23114371-23114393 GATGCAATGGGGAAAGGTGTTGG - Intergenic
928923298 2:36548992-36549014 GTTTGGATGGGGAAATGGGTGGG + Exonic
930156755 2:48113785-48113807 GAAACAAAGGGGAAAAGGTTAGG - Intergenic
931113442 2:59138553-59138575 GTTATAGTGGGAAAGAGGGTGGG - Intergenic
932947755 2:76257098-76257120 ATTACAACTGAGAAAAGGGTAGG + Intergenic
937353465 2:121183622-121183644 GGTACAATGGGGAGACAGGTAGG - Intergenic
940766496 2:157795798-157795820 GAGAGAATGGGGAAAAGAGTGGG - Intronic
941064088 2:160881210-160881232 GTTACAATAGGCAAAAGGGAGGG - Intergenic
943423384 2:187698123-187698145 GTTACACTGAGGCAAAAGGTGGG - Intergenic
943553287 2:189368036-189368058 ATAAAAATGGGGATAAGGGTGGG - Intergenic
944678660 2:202055839-202055861 GTGGTAATTGGGAAAAGGGTGGG + Intergenic
945628663 2:212242976-212242998 CATGCAATGGGGAAAAGGGGAGG - Intronic
946990099 2:225318791-225318813 GTTAAAAGGGGGATGAGGGTGGG - Intergenic
1168964366 20:1890398-1890420 GATAAAATAGGGAAGAGGGTAGG + Intergenic
1169531957 20:6494860-6494882 GTTACAATAGGTACAAGAGTAGG - Intergenic
1169804065 20:9541499-9541521 GTCAGAAAGGGGAAAAAGGTAGG - Intronic
1170365800 20:15597336-15597358 TTTACAGTGGTGCAAAGGGTAGG + Intronic
1170953138 20:20954802-20954824 GCTTCAATTGGGAAAAGTGTGGG + Intergenic
1174127058 20:48314388-48314410 ATTATAATGGGGAAAAGGAAAGG - Intergenic
1174606245 20:51763813-51763835 GTTACAATGAGGCAAAGTCTTGG + Intronic
1176659769 21:9623462-9623484 TTTACAATGTTGAAAATGGTTGG + Intergenic
1177559566 21:22731979-22732001 TTTACAGTGAGGAAAAGGGAAGG + Intergenic
1183082751 22:35467261-35467283 TTTAAAATGGGCAAAAGGCTGGG - Intergenic
949910499 3:8902196-8902218 ATTACTATGGGGAAAGTGGTTGG - Intronic
953728204 3:45419642-45419664 GAAACAATGGGAAAAAGGTTTGG - Intronic
954584425 3:51721095-51721117 GTTACATTGGGCAAAGGGGCTGG + Intergenic
955185399 3:56710303-56710325 GGTACAATGTGGAAAAGGAATGG - Intergenic
957941127 3:87005351-87005373 GATATAATGGAGAAAAAGGTGGG + Intergenic
960942405 3:122943413-122943435 GTAACAAGGGGCAGAAGGGTCGG - Intronic
961133017 3:124486370-124486392 GTTAAAATAAGGAAAGGGGTGGG + Intronic
962051452 3:131820064-131820086 GTTACAATGGGAAAAATATTAGG + Intronic
963190599 3:142467508-142467530 CTTACGATAGGGAAGAGGGTTGG - Intronic
963353474 3:144180787-144180809 GTGGCAATTGGTAAAAGGGTAGG + Intergenic
963762017 3:149294020-149294042 GGGGCTATGGGGAAAAGGGTAGG - Intergenic
964139760 3:153384331-153384353 TTTAGAATGGGAAAAAGGGAAGG + Intergenic
965128542 3:164663275-164663297 GTTAGGATGGGGAATAGGGAGGG - Intergenic
967439815 3:189493512-189493534 GTTACAAAGGGAAAAACGGTAGG + Intergenic
968556259 4:1247895-1247917 CTTCCAGTGGGGAAAAGGGAAGG - Intronic
969471275 4:7390751-7390773 GTTACATTGGGGAAAGGATTTGG + Intronic
970197300 4:13564317-13564339 GGTACAATTGGGATAAGGGATGG + Intergenic
970879465 4:20911493-20911515 TATACAAAGGAGAAAAGGGTGGG + Intronic
971773604 4:30931152-30931174 GGTATAGTGGGGAAAAGGGGTGG - Intronic
973732146 4:53833019-53833041 GGCACACTGGTGAAAAGGGTGGG - Intronic
973981050 4:56308672-56308694 GTCACAATGGGCAACAGGGGAGG - Intronic
975743046 4:77449256-77449278 ATTACAAAGGGGAAAATGGCAGG - Intergenic
975891828 4:79038592-79038614 TTTAAAATGGGGAAAAGAATAGG + Intergenic
976384320 4:84437893-84437915 CTCACTATGGGGAAAAGTGTGGG - Intergenic
976564054 4:86533232-86533254 GTTACGAGGGGTAAAAGGGGGGG + Intronic
976627264 4:87199691-87199713 TTTAAAATGGGCAAAAGGTTGGG + Intronic
977035620 4:91948805-91948827 GATAGATTGGGGAGAAGGGTAGG - Intergenic
977672759 4:99715212-99715234 TTTACAATGGAAAAAAGGGAAGG + Intergenic
977777035 4:100933089-100933111 GTAACAATGAGGAAAAGAGTAGG + Intergenic
981392759 4:144211038-144211060 GTTACAATGAGGGAGAGGTTTGG + Intergenic
981690828 4:147506988-147507010 TTCACAATGGGAATAAGGGTTGG + Intronic
985415612 4:189732945-189732967 TTTACAATGTTGAAAATGGTTGG - Intergenic
987034339 5:14005170-14005192 GTAACAATGTGGCAAAGGGGAGG - Intergenic
987240827 5:15996947-15996969 ACTACAATGGGAAAAAGGGCTGG - Intergenic
987536816 5:19200241-19200263 GTTGCAGAGGGGAAGAGGGTTGG - Intergenic
988668876 5:33359980-33360002 GTTACACTGAAGCAAAGGGTGGG + Intergenic
989000894 5:36759186-36759208 GTTACAGTGGGAAATAAGGTGGG + Intergenic
989028381 5:37091725-37091747 GTTAATGTGGGGAAGAGGGTAGG + Intergenic
991920089 5:71648006-71648028 GTTACAATGGAGTCAAGGCTGGG + Intronic
994297433 5:98107671-98107693 CTGAGAATAGGGAAAAGGGTGGG + Intergenic
996724671 5:126663835-126663857 GTTACAATGTTGCAAAGGGCTGG - Intergenic
996799160 5:127383652-127383674 TTTACCTTTGGGAAAAGGGTAGG + Intronic
998611893 5:143698308-143698330 GTTACAATGGAGACAAGCATTGG + Intergenic
999322972 5:150626098-150626120 GGTACACTGGGGCAAGGGGTTGG + Intronic
1001003018 5:168025578-168025600 GCTACATTGGGAAATAGGGTAGG + Intronic
1001895482 5:175376188-175376210 GTTAGAATGGGGAAACGAGAGGG - Intergenic
1004336934 6:14772281-14772303 ATTAGAATGGGGAAGAGGGCAGG - Intergenic
1005876206 6:30011558-30011580 GATGCAGTGGGGAAAATGGTGGG + Intergenic
1008103508 6:47418090-47418112 TTTAAAATGGGCAAAAGGTTGGG - Intergenic
1012421165 6:99066733-99066755 GTCACAATGGGGAACCAGGTGGG + Intergenic
1013904336 6:115198016-115198038 GATACAATGGGGTAAAGTATTGG + Intergenic
1014284136 6:119477312-119477334 GTTACTATGTGTAAAAGGCTTGG + Intergenic
1014746890 6:125210876-125210898 GTTACAAAGTTGAAAAGGGGTGG + Intronic
1016135644 6:140538690-140538712 TTTTCAATGGGGAAAAAGGCAGG - Intergenic
1016212914 6:141562248-141562270 GAAACAGTGGGGAAAAGGGGAGG - Intergenic
1016672856 6:146729060-146729082 CTAACAGTGGGGAAAAGAGTTGG - Intronic
1017148845 6:151259875-151259897 GTTACATTGAAGAAAAGGGTCGG - Intronic
1019190996 6:170250709-170250731 GTTTCAAGGGGGAAAAGGAAAGG + Intergenic
1020709771 7:11592645-11592667 ACTAATATGGGGAAAAGGGTTGG - Intronic
1021761936 7:23910715-23910737 GACACACTGGGGAAAAGGTTAGG - Intergenic
1021946400 7:25732123-25732145 TTCACACTGGAGAAAAGGGTTGG - Intergenic
1023028261 7:36071444-36071466 GTGACCATGAGGAAAAGGCTGGG + Intergenic
1023041428 7:36176147-36176169 GATGCAGTGGGGGAAAGGGTGGG + Intronic
1023768823 7:43536414-43536436 GCTAGAATGGGGAAAAGGCTGGG + Intronic
1024142951 7:46480615-46480637 GTTACACTGGGGAAGAGGGGTGG + Intergenic
1026262493 7:68767085-68767107 GTAAGAATGGAGAAAAGGGCCGG - Intergenic
1026444384 7:70471325-70471347 GGTAGAATGGGGGAAAGGGAAGG + Intronic
1027682285 7:81235890-81235912 GTTCCAATGGGGAAAGTGGAAGG - Intergenic
1027820887 7:83043112-83043134 GTCACAATGGGGAAAGGGAAGGG - Intronic
1028438495 7:90831703-90831725 CAGATAATGGGGAAAAGGGTGGG - Intronic
1031529356 7:122857464-122857486 GTTACTTTGGGGAAAGGAGTGGG + Intronic
1033034642 7:137862747-137862769 ATTAAAATGGGGAAAAGGAAAGG + Intergenic
1033482804 7:141758917-141758939 GTTAGATTGGGGAAAAAGGGTGG - Intronic
1033634275 7:143195085-143195107 GTTATAAGGTGGAAAAGGGAAGG - Intergenic
1034004404 7:147453212-147453234 TTTACCAGGAGGAAAAGGGTTGG - Intronic
1036245790 8:7115600-7115622 GATACACTGGGGACATGGGTTGG + Intergenic
1037632027 8:20666906-20666928 GTTTCAATAGGTAATAGGGTGGG + Intergenic
1038094365 8:24291304-24291326 TTAAAAATGGGCAAAAGGGTGGG - Intergenic
1039579994 8:38657714-38657736 GTGAGAATGGGGGAAGGGGTGGG - Intergenic
1040674680 8:49734352-49734374 TTTACAATGGAGAAAACTGTTGG + Intergenic
1041578851 8:59433488-59433510 TTTAAAATAGGGAATAGGGTGGG - Intergenic
1042853680 8:73242319-73242341 TTTAAAATGGGCAAAAGGGGTGG + Intronic
1043275359 8:78385683-78385705 GATACAATGGGGCAGGGGGTTGG - Intergenic
1043368675 8:79565229-79565251 GTTACCATTTGGAAAAGAGTTGG - Intergenic
1043557262 8:81445596-81445618 TTTTCAATGGGGAATAGGATTGG - Intronic
1043972301 8:86545119-86545141 GATACAATAGGCAAAAGGATTGG - Intronic
1044380963 8:91532868-91532890 GTTATACTGGGGAAAGGGTTTGG + Intergenic
1045000323 8:97872681-97872703 GTCAGGATGGGGAGAAGGGTTGG - Intronic
1045273658 8:100682599-100682621 GTTAAAATGGGGATGAGGCTGGG - Intergenic
1046029204 8:108763189-108763211 GTTACAATGGGGAAAAGGGTTGG - Intronic
1048745145 8:137606237-137606259 GGAACAATGGTGATAAGGGTTGG - Intergenic
1050116606 9:2270048-2270070 ATTACAAGGGGGTAATGGGTAGG - Intergenic
1050572917 9:6960110-6960132 GTCACAATGGAGAAAAAGCTTGG + Intronic
1050925343 9:11256903-11256925 GTTAACATGGGGAAGAGGATAGG - Intergenic
1051194313 9:14546836-14546858 GCCACACTGGGGCAAAGGGTGGG + Intergenic
1058535991 9:105960817-105960839 GGTACAATGGTGAAGAGGGCAGG - Intergenic
1059125548 9:111681154-111681176 AGTACAATATGGAAAAGGGTAGG + Intergenic
1059611289 9:115899384-115899406 GGAACAAAGGGGAAAAGGGGAGG + Intergenic
1059667551 9:116463136-116463158 GTTGCAATGGAGAAAAAGGCGGG - Intronic
1060445496 9:123683573-123683595 GTAAAAATGAGGAAAAGGTTAGG - Intronic
1203637329 Un_KI270750v1:125306-125328 TTTACAATGTTGAAAATGGTTGG + Intergenic
1185685924 X:1928353-1928375 GAGACAATGAGGACAAGGGTAGG - Intergenic
1186335117 X:8578405-8578427 TTTCCAATGGGCAAAAGGCTTGG - Intronic
1186350429 X:8733424-8733446 ATAAGAATAGGGAAAAGGGTGGG - Intergenic
1187400003 X:18951046-18951068 GTGACAATCCGGAAAAGGGGTGG - Intronic
1188224484 X:27580294-27580316 GTTTCAATGGGGAAAAAGACAGG + Intergenic
1190160082 X:48025878-48025900 GTGACAAAGAGGAAAAGGGAAGG + Intronic
1190571469 X:51786720-51786742 ATTACTACTGGGAAAAGGGTAGG + Intergenic
1191883318 X:65863784-65863806 GATACAAGGGGGCAAAGGGCAGG - Intergenic
1192030588 X:67508557-67508579 GTGGCAATGGGGGGAAGGGTTGG + Intergenic
1192981806 X:76351914-76351936 GTTTCATTGGGGTGAAGGGTCGG - Intergenic
1195082576 X:101385437-101385459 GTAACAATGGGTAAAAGACTGGG - Intronic
1197353788 X:125409356-125409378 GTAGCAGTGGGGAACAGGGTAGG - Intergenic
1198099009 X:133407615-133407637 ATAATAATGGTGAAAAGGGTGGG - Intronic
1198177915 X:134173515-134173537 GTAACAATGGTGGAAAGGGAGGG - Intergenic
1198266193 X:135011156-135011178 CTTACATTGTGGAAAAGGATTGG + Intergenic
1198503647 X:137279825-137279847 GGTACAATGGTTAAAAGCGTGGG - Intergenic
1201773890 Y:17644065-17644087 GTTCTAAAGGGGAAAAGGGAAGG + Intergenic
1201827667 Y:18261924-18261946 GTTCTAAAGGGGAAAAGGGAAGG - Intergenic
1201899381 Y:19032755-19032777 GTCACATTGGGGAAAAGGCAAGG - Intergenic