ID: 1046036687 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:108851295-108851317 |
| Sequence | GTTCCAAGGAATGTATTTTG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1046036687_1046036693 | 5 | Left | 1046036687 | 8:108851295-108851317 | CCCCAAAATACATTCCTTGGAAC | No data | ||
| Right | 1046036693 | 8:108851323-108851345 | TACTGCGTAATACGGTTCTACGG | No data | ||||
| 1046036687_1046036691 | -3 | Left | 1046036687 | 8:108851295-108851317 | CCCCAAAATACATTCCTTGGAAC | No data | ||
| Right | 1046036691 | 8:108851315-108851337 | AACACCAATACTGCGTAATACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1046036687 | Original CRISPR | GTTCCAAGGAATGTATTTTG GGG (reversed) | Intergenic | ||