ID: 1046036687

View in Genome Browser
Species Human (GRCh38)
Location 8:108851295-108851317
Sequence GTTCCAAGGAATGTATTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046036687_1046036691 -3 Left 1046036687 8:108851295-108851317 CCCCAAAATACATTCCTTGGAAC No data
Right 1046036691 8:108851315-108851337 AACACCAATACTGCGTAATACGG No data
1046036687_1046036693 5 Left 1046036687 8:108851295-108851317 CCCCAAAATACATTCCTTGGAAC No data
Right 1046036693 8:108851323-108851345 TACTGCGTAATACGGTTCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046036687 Original CRISPR GTTCCAAGGAATGTATTTTG GGG (reversed) Intergenic
No off target data available for this crispr