ID: 1046036691

View in Genome Browser
Species Human (GRCh38)
Location 8:108851315-108851337
Sequence AACACCAATACTGCGTAATA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046036687_1046036691 -3 Left 1046036687 8:108851295-108851317 CCCCAAAATACATTCCTTGGAAC No data
Right 1046036691 8:108851315-108851337 AACACCAATACTGCGTAATACGG No data
1046036688_1046036691 -4 Left 1046036688 8:108851296-108851318 CCCAAAATACATTCCTTGGAACA No data
Right 1046036691 8:108851315-108851337 AACACCAATACTGCGTAATACGG No data
1046036689_1046036691 -5 Left 1046036689 8:108851297-108851319 CCAAAATACATTCCTTGGAACAC No data
Right 1046036691 8:108851315-108851337 AACACCAATACTGCGTAATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046036691 Original CRISPR AACACCAATACTGCGTAATA CGG Intergenic
No off target data available for this crispr