ID: 1046036693

View in Genome Browser
Species Human (GRCh38)
Location 8:108851323-108851345
Sequence TACTGCGTAATACGGTTCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046036688_1046036693 4 Left 1046036688 8:108851296-108851318 CCCAAAATACATTCCTTGGAACA No data
Right 1046036693 8:108851323-108851345 TACTGCGTAATACGGTTCTACGG No data
1046036687_1046036693 5 Left 1046036687 8:108851295-108851317 CCCCAAAATACATTCCTTGGAAC No data
Right 1046036693 8:108851323-108851345 TACTGCGTAATACGGTTCTACGG No data
1046036690_1046036693 -9 Left 1046036690 8:108851309-108851331 CCTTGGAACACCAATACTGCGTA No data
Right 1046036693 8:108851323-108851345 TACTGCGTAATACGGTTCTACGG No data
1046036689_1046036693 3 Left 1046036689 8:108851297-108851319 CCAAAATACATTCCTTGGAACAC No data
Right 1046036693 8:108851323-108851345 TACTGCGTAATACGGTTCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046036693 Original CRISPR TACTGCGTAATACGGTTCTA CGG Intergenic