ID: 1046037011

View in Genome Browser
Species Human (GRCh38)
Location 8:108854655-108854677
Sequence TCTTAACCAGAGCTCTGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046037011_1046037014 -6 Left 1046037011 8:108854655-108854677 CCACTTCAGAGCTCTGGTTAAGA No data
Right 1046037014 8:108854672-108854694 TTAAGAAATTTTTTCCTGGGAGG No data
1046037011_1046037015 3 Left 1046037011 8:108854655-108854677 CCACTTCAGAGCTCTGGTTAAGA No data
Right 1046037015 8:108854681-108854703 TTTTTCCTGGGAGGAGAAGCAGG No data
1046037011_1046037012 -10 Left 1046037011 8:108854655-108854677 CCACTTCAGAGCTCTGGTTAAGA No data
Right 1046037012 8:108854668-108854690 CTGGTTAAGAAATTTTTTCCTGG No data
1046037011_1046037013 -9 Left 1046037011 8:108854655-108854677 CCACTTCAGAGCTCTGGTTAAGA No data
Right 1046037013 8:108854669-108854691 TGGTTAAGAAATTTTTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046037011 Original CRISPR TCTTAACCAGAGCTCTGAAG TGG (reversed) Intergenic
No off target data available for this crispr