ID: 1046037977

View in Genome Browser
Species Human (GRCh38)
Location 8:108867102-108867124
Sequence CTATAGGAATTGAGGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046037977_1046037983 5 Left 1046037977 8:108867102-108867124 CCATGTTCCCTCAATTCCTATAG No data
Right 1046037983 8:108867130-108867152 GTCTTTTTAATAATTTAATATGG No data
1046037977_1046037984 27 Left 1046037977 8:108867102-108867124 CCATGTTCCCTCAATTCCTATAG No data
Right 1046037984 8:108867152-108867174 GATTTCAGATTATAGATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046037977 Original CRISPR CTATAGGAATTGAGGGAACA TGG (reversed) Intergenic
No off target data available for this crispr