ID: 1046053716

View in Genome Browser
Species Human (GRCh38)
Location 8:109054831-109054853
Sequence AAGGAGCAGGAGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046053716_1046053724 5 Left 1046053716 8:109054831-109054853 CCTTCCTCCTCCTCCTGCTCCTT No data
Right 1046053724 8:109054859-109054881 TACCTTACTTCTTGCACAGCTGG No data
1046053716_1046053726 24 Left 1046053716 8:109054831-109054853 CCTTCCTCCTCCTCCTGCTCCTT No data
Right 1046053726 8:109054878-109054900 CTGGAAGTGATTTTGTTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046053716 Original CRISPR AAGGAGCAGGAGGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr