ID: 1046071871

View in Genome Browser
Species Human (GRCh38)
Location 8:109265501-109265523
Sequence ATGTCATTATGAAAGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 309}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046071871 Original CRISPR ATGTCATTATGAAAGGAAGT AGG (reversed) Intronic
902073685 1:13765205-13765227 ATGTCATTAACAAAAGAACTGGG - Intronic
903159064 1:21471841-21471863 ATGTCATTGTGAAAGTATGGAGG - Intronic
904241762 1:29151133-29151155 ATCTCATTATGACAGAAAGAGGG + Intronic
905941884 1:41869863-41869885 ATGTCATGATGAAAGCTAATGGG - Intronic
905957270 1:42008775-42008797 ATGTTATTATGAAAAGTATTGGG - Intronic
906102809 1:43273928-43273950 ATGTCATTGTGTATGGAAGGCGG + Exonic
908048686 1:60203135-60203157 ATGTCTTTATTAAAGTCAGTTGG - Intergenic
908970131 1:69818308-69818330 GTTTCATTATGAAAGGATGTTGG + Intronic
909368830 1:74860658-74860680 ATGTGATTATGTAGGGAAGGGGG + Intergenic
910417581 1:87016909-87016931 ATGACATTTTAAAAGGAACTTGG + Intronic
911237735 1:95429652-95429674 ATGTCCTTATGAAAGATACTGGG + Intergenic
911336532 1:96587745-96587767 TGGTCATTGGGAAAGGAAGTAGG + Intergenic
911528228 1:99012122-99012144 AAGTCATTTTGAAAGAAAGTTGG - Intergenic
914732789 1:150386566-150386588 ATGACATTATCAAAAAAAGTTGG - Intronic
914899850 1:151706111-151706133 GTGTCAGGATGAAAGCAAGTGGG - Intronic
915893089 1:159789500-159789522 ATATTACAATGAAAGGAAGTGGG + Intergenic
917166842 1:172122113-172122135 ATGTGATTAAAAAAGTAAGTTGG - Intronic
917278699 1:173358138-173358160 ACGTGATGATGGAAGGAAGTTGG + Intergenic
917884365 1:179368853-179368875 AACTCATTCTGAAGGGAAGTAGG - Exonic
919660621 1:200241332-200241354 ATGTGATTATGCAAGGAAGGAGG + Intergenic
921018849 1:211217691-211217713 ATGATATGATGGAAGGAAGTGGG + Intergenic
921436096 1:215124368-215124390 ATGACAATATGAAAGCATGTTGG + Intronic
921605065 1:217142026-217142048 CTGTCTTTCTCAAAGGAAGTAGG + Intergenic
922159527 1:223068414-223068436 ATACCATTATGAAAATAAGTGGG + Intergenic
923966164 1:239141290-239141312 AAGTCTTAATAAAAGGAAGTAGG + Intergenic
924706738 1:246508422-246508444 ATGTCATTATTAAGGGCAGCTGG + Intergenic
1066757124 10:38722459-38722481 GTGACGTTAGGAAAGGAAGTAGG - Intergenic
1068610132 10:59050309-59050331 TTTTTATTATGAAAGGATGTTGG + Intergenic
1068973198 10:62980735-62980757 TTGTCATAAGGAAAGGAAGATGG - Intergenic
1073533047 10:104250601-104250623 ATGTCAACATAAAAGGAAGAGGG + Intronic
1073874043 10:107900620-107900642 ATGTCCTTAAGGAAGCAAGTTGG + Intergenic
1074496385 10:113983480-113983502 ATGTGAACATGAGAGGAAGTAGG - Intergenic
1076033575 10:127179682-127179704 ATTTTGTTATGAAAGGAAATGGG + Intronic
1077507426 11:2937009-2937031 ATTTAATTATTAAAGGAGGTTGG - Intergenic
1078080188 11:8198499-8198521 ATGCCGTTATGGAAGGAATTCGG + Intergenic
1079304828 11:19312694-19312716 ATTACATTAAGAAATGAAGTTGG - Intergenic
1079781696 11:24615172-24615194 ATGTCATTATTAGAGAAACTGGG - Intronic
1080114026 11:28601696-28601718 ATGTGATTGTGTTAGGAAGTGGG - Intergenic
1081032367 11:38100266-38100288 TTGTTGTTAAGAAAGGAAGTGGG + Intergenic
1083402117 11:62430758-62430780 AGATCCTTATGAATGGAAGTGGG - Intergenic
1083819204 11:65157516-65157538 ATGGCCTTATGACAGGAAGCTGG + Intergenic
1086207070 11:84271739-84271761 ATGTGAATAGGAAAGTAAGTTGG - Intronic
1086755941 11:90562084-90562106 GTTTTATCATGAAAGGAAGTTGG - Intergenic
1087365779 11:97217204-97217226 AGGACAGAATGAAAGGAAGTAGG - Intergenic
1088792140 11:113235433-113235455 AACACATTATTAAAGGAAGTGGG + Intronic
1090020890 11:123127420-123127442 AAGTCATTATAAAAAGAGGTGGG - Intronic
1090036466 11:123253668-123253690 ATGTTTTTATAAAAGGAAGGAGG + Intergenic
1090222421 11:125040000-125040022 ATGTCATCATAGAATGAAGTTGG - Intronic
1091317448 11:134624522-134624544 ATTTCAGTAGGAAAGGAAATAGG + Intergenic
1091350460 11:134890164-134890186 ATGTCATAATGAAATGACTTAGG + Intergenic
1093557641 12:20495644-20495666 ATGTCATTATTAATTGTAGTAGG - Intronic
1093889312 12:24500588-24500610 AAGCCATTATGAAAGGAAGGGGG - Intergenic
1095173876 12:39067543-39067565 AAGACATACTGAAAGGAAGTGGG + Intergenic
1095449971 12:42320304-42320326 AGATCATTATGAAATAAAGTGGG - Intronic
1095545762 12:43367469-43367491 GTGTTATTATGAAAGGATGCTGG - Intronic
1095879949 12:47123081-47123103 ATGTAATTATGCTAGAAAGTAGG - Intronic
1098754486 12:74342066-74342088 ATGTGATTATGAAGGGATATAGG - Intergenic
1099652753 12:85449480-85449502 ATGTCCTAAAGAAAGGAAATTGG - Intergenic
1100321494 12:93497525-93497547 TTTTCATCATGAAAGGATGTTGG - Intronic
1100714702 12:97293625-97293647 ATGTCATCCTGCAAGGATGTGGG - Intergenic
1104358969 12:128114267-128114289 ATCTCATGAAGACAGGAAGTTGG - Intergenic
1106254470 13:28010211-28010233 AAGTCAGCATGAAAGCAAGTTGG - Intronic
1107306064 13:39021070-39021092 ATGTCATTAGCAAAGTAAATGGG + Intronic
1107444324 13:40456982-40457004 ATGTCTTTATAGAAGGAAGAGGG + Intergenic
1108550091 13:51535480-51535502 ATGTCTTTATAAAAGTAAGAGGG + Intergenic
1109464365 13:62710053-62710075 ATTTTAATATGAAAGGACGTTGG + Intergenic
1109481968 13:62966810-62966832 ATGTTAATAAGGAAGGAAGTTGG + Intergenic
1109743939 13:66595268-66595290 ATATCTTTATGACAGGAGGTAGG - Intronic
1109826795 13:67732036-67732058 ATTTCCTGATGAAATGAAGTAGG - Intergenic
1109838508 13:67890712-67890734 ATTTCATTAGGAAAGGACATTGG + Intergenic
1110823036 13:79938313-79938335 ATAGCATTATAAAGGGAAGTAGG + Intergenic
1111900691 13:94196122-94196144 TTGTCATTATCAGAGGAAGCCGG + Intronic
1112994789 13:105560429-105560451 ATGTGATGATGTGAGGAAGTGGG - Intergenic
1113093698 13:106640705-106640727 AGGGCATTCTGAAAGGAATTGGG + Intergenic
1114376399 14:22151299-22151321 ATATCTTTATGACAGGAGGTTGG - Intergenic
1114494774 14:23125202-23125224 ATGTCATTCTGGAAGGAACCTGG + Intergenic
1115065010 14:29248410-29248432 TTCTCATCATGAATGGAAGTTGG + Intergenic
1115471292 14:33771213-33771235 TTGGCATTATGAAATGAATTTGG + Intronic
1115873623 14:37835522-37835544 ATGTCATTAGGGAAGGCAGAGGG + Intronic
1116190418 14:41658363-41658385 AAGTCATGATTAAAGGAAGATGG - Intronic
1116423140 14:44756882-44756904 ATGCCATTCTGGAAAGAAGTAGG + Intergenic
1117251208 14:53940561-53940583 ATGTCATGATGAAATGTATTTGG - Intergenic
1117725006 14:58664408-58664430 ATGTCATTATGAAAAAAATGGGG + Intergenic
1117858599 14:60063714-60063736 ATGTCATTATGAAAAGTCATAGG + Intergenic
1118344755 14:64929798-64929820 ATGCCATTATTAAACAAAGTAGG + Intronic
1118363512 14:65075404-65075426 AGGACAGTAGGAAAGGAAGTGGG + Intronic
1118700181 14:68425425-68425447 ATGCCATTATCAAGAGAAGTGGG + Intronic
1118896334 14:69948951-69948973 TTGTTATAATGAAAGGCAGTGGG - Intronic
1120211116 14:81634804-81634826 ATGTCATGATAGAAGGGAGTAGG + Intergenic
1120213508 14:81657803-81657825 ATGTCATTAACAAAGGAAGGAGG + Intergenic
1120256590 14:82127727-82127749 ATATCATTAAGAAAAGAATTTGG - Intergenic
1120966875 14:90175315-90175337 ATGTCTTTTTGAGATGAAGTAGG - Intronic
1122366372 14:101197223-101197245 ATTTCATTATGAAAGCAACCAGG + Intergenic
1202892736 14_KI270722v1_random:175017-175039 ATTTCATCATGAAAGGCTGTTGG - Intergenic
1123663601 15:22587869-22587891 ATGACATTTTGGAAGGAGGTTGG - Intergenic
1123923982 15:25090575-25090597 AGGTCATCATGAAATGAAATGGG - Intergenic
1124114346 15:26827351-26827373 CTGTCATCAAGAAAGTAAGTGGG - Intronic
1124317432 15:28682321-28682343 ATGACATTTTGGAAGGAGGTTGG - Intergenic
1124566015 15:30815192-30815214 ATGACATTTTGGAAGGAGGTTGG + Intergenic
1127603247 15:60560347-60560369 ATTTCATTAACAAAGGAACTGGG + Intronic
1127731430 15:61805801-61805823 ATGTAATTTTGGGAGGAAGTAGG + Intergenic
1128868983 15:71138020-71138042 AGGGCAATATGAAAGGAAGAAGG - Intronic
1129008297 15:72393417-72393439 ATGTGATTCAGAAAGCAAGTAGG + Intergenic
1129590035 15:76906762-76906784 TTATGAGTATGAAAGGAAGTGGG - Intergenic
1133647785 16:7780634-7780656 ATGTCCTTAAAAAAGGAAGAAGG - Intergenic
1134344735 16:13379258-13379280 ATCTTATTTTGGAAGGAAGTGGG + Intergenic
1135890926 16:26356492-26356514 ATGTGATTATAATTGGAAGTTGG - Intergenic
1137930092 16:52578877-52578899 ATGCAATTATGAAAGGAGGGAGG + Intergenic
1139353093 16:66350243-66350265 AAGTCATTTTAAAAAGAAGTGGG + Intergenic
1140568385 16:76072202-76072224 ATGTCTTTATGAGAGAAATTTGG - Intergenic
1140642670 16:76994622-76994644 ATATCATCATGAAGGGAAATAGG + Intergenic
1141339552 16:83190233-83190255 ATCTCATTATGAGTGGAAGTGGG + Intronic
1145356821 17:22165948-22165970 ATGTTAATAAGGAAGGAAGTTGG - Intergenic
1146847330 17:36191110-36191132 AGTCCATTAAGAAAGGAAGTGGG + Intronic
1147519418 17:41155250-41155272 ATGTCATTTTTAATGGAATTAGG - Intergenic
1149576560 17:57717410-57717432 AAGTCATTAAGAAAGGAGGCAGG + Intergenic
1150089617 17:62311797-62311819 ATGGCATTGTGGAATGAAGTTGG + Intergenic
1150583121 17:66493425-66493447 ATGACATGATGAAAGGACGGGGG + Intronic
1150870245 17:68900849-68900871 TTGTCATTATGAACAGATGTTGG - Intronic
1153559726 18:6359928-6359950 AAGTAATTATGAAAGCAAGAAGG - Intronic
1153840548 18:9004088-9004110 ATTTGATTATGAAATTAAGTTGG + Intergenic
1154263123 18:12855266-12855288 ATGTAGGTAAGAAAGGAAGTGGG + Intronic
1154372992 18:13782341-13782363 GTGTCATCATGAAGGGATGTTGG - Intergenic
1154390080 18:13929311-13929333 ATGTTCCTATGAAAGGAAGCAGG + Intergenic
1156306546 18:35883294-35883316 TTGTTATTCTGAAAGGAAGCTGG - Intergenic
1156580322 18:38367492-38367514 ATGTCATTCTGAAAAGAAGGAGG + Intergenic
1156624259 18:38889399-38889421 AGGTCAGTAGGAAGGGAAGTTGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158334650 18:56402732-56402754 ATGTCCTTATGAAACGGAGAAGG + Intergenic
1158430846 18:57385953-57385975 ATGTCTTACTTAAAGGAAGTGGG - Intergenic
1159604210 18:70458157-70458179 ATTTGATAAAGAAAGGAAGTTGG - Intergenic
1160170256 18:76547193-76547215 ATGTCATTCTGAAGAGAGGTCGG - Intergenic
1160368921 18:78355012-78355034 AACTCACTAAGAAAGGAAGTGGG + Intergenic
1162559629 19:11408872-11408894 TTGTCTTTAAGAAAGGAAGAAGG + Intronic
1168574790 19:57500646-57500668 ATGTGACTGTGAAAGAAAGTAGG + Intronic
1168700791 19:58438311-58438333 ATGTGATTATGAAATTATGTCGG - Intronic
925154000 2:1636513-1636535 CTGTCATTATGAAATGCAGATGG - Intronic
928542623 2:32297440-32297462 ATTTCCTAATTAAAGGAAGTAGG - Intronic
929252369 2:39773021-39773043 ATGACATTATGGGAGGAAGCAGG + Intronic
929813439 2:45211802-45211824 ATGGCATGAGGAAAGGAAGGAGG - Intergenic
930963937 2:57296723-57296745 ATGTCAAGATTACAGGAAGTGGG + Intergenic
933074865 2:77910878-77910900 ATGTCATGTTGAAAGAAAATAGG + Intergenic
933602825 2:84350248-84350270 AAGTCATAATGCAAGGAAGTGGG + Intergenic
933785858 2:85841051-85841073 TTGTCATTGAGAGAGGAAGTAGG - Intronic
933848156 2:86342475-86342497 ATGTAATTATAAAAGAAACTGGG - Intergenic
934320433 2:91966901-91966923 GTGACGTTAGGAAAGGAAGTAGG - Intergenic
934960898 2:98671801-98671823 GCGTCTTTATGAAAGGAAGGAGG + Intronic
935589570 2:104834181-104834203 ATGTCGGTAAGAAATGAAGTTGG - Intergenic
937574518 2:123403137-123403159 ATGGCATTTTTAAAGGAAGGAGG + Intergenic
937819437 2:126292122-126292144 ATTTTATTATAAAAGGATGTTGG - Intergenic
937930084 2:127197833-127197855 ATGTGCTTTTGAAAGGAACTTGG + Intronic
938058944 2:128237427-128237449 ATGTCAGTCTGATAGAAAGTTGG + Intronic
939021404 2:136962057-136962079 ATGTCCTTATGAGTGGAAGAGGG + Intronic
939612121 2:144324334-144324356 ATATCATTTTAAAAGGAAGTAGG - Intronic
939618738 2:144391693-144391715 ATGTCATTATGTTATGAATTTGG + Intronic
942529258 2:176891111-176891133 ATGTCTTTGTGAAAGGCTGTTGG + Intergenic
942552391 2:177132845-177132867 GTGTCATCCTGATAGGAAGTGGG - Intergenic
943501300 2:188693076-188693098 ATGACAGTATGACAGAAAGTGGG + Intergenic
944340347 2:198588957-198588979 ATGTCATTTACAAAGTAAGTGGG + Intergenic
944379463 2:199091584-199091606 ATGCCATGATGAAAGGCAGATGG + Intergenic
944623829 2:201548675-201548697 ATGTCCTCATGAAATGAACTGGG - Intronic
945209325 2:207366036-207366058 CTGGCATTTTAAAAGGAAGTTGG + Intergenic
945663657 2:212716346-212716368 ATGCCATGGTGAAAGGAAGAAGG + Intergenic
1173460163 20:43236811-43236833 ATGTTCATATGACAGGAAGTGGG + Intergenic
1174698896 20:52587963-52587985 ATGTTATTATGAGAAGAAGGAGG + Intergenic
1174798503 20:53542477-53542499 ATGTCATAATGAAAGGCCATAGG - Intergenic
1177850524 21:26341820-26341842 ATATCATTATGACTCGAAGTGGG + Intergenic
1182511455 22:30822986-30823008 ATATCTTTATGAAAAGAAGGGGG + Intronic
1183797096 22:40128393-40128415 AGGCCATTAGGAAAGGTAGTAGG + Intronic
1183807730 22:40225905-40225927 ATGTCATTTTAAATGGAACTGGG + Intronic
950504107 3:13383332-13383354 ATGACATGATGAAAGGGAGGTGG + Intronic
950766052 3:15273884-15273906 ATGTGATTATATTAGGAAGTGGG + Intronic
951356359 3:21671753-21671775 AGGTTTTTATGAAAGGAAGGTGG + Intronic
951505329 3:23438582-23438604 ATAGCATTATGATAGGCAGTTGG + Intronic
951577486 3:24128579-24128601 ATGCCATTATCAAAGGAGTTTGG + Intronic
951858010 3:27219280-27219302 ATATCTTTATGACAGGAGGTAGG - Intronic
952220684 3:31321192-31321214 ATGTTTTTTTGAAAGGAATTAGG + Intergenic
952726505 3:36591998-36592020 ATGTGATGATGTTAGGAAGTGGG - Intergenic
954263285 3:49455289-49455311 ATTTCATTATGAAAGGAATCAGG + Intergenic
955897636 3:63717571-63717593 ATGTTCTTATGAATGGAAGAGGG - Intergenic
956118279 3:65940572-65940594 ATGTGATGGTGTAAGGAAGTGGG - Intronic
956273549 3:67473649-67473671 ATATCATTTTAAAATGAAGTTGG - Intronic
956811522 3:72868021-72868043 AGGTCATTATAAAAGCATGTTGG + Intergenic
956864769 3:73358218-73358240 ATTTTATTATGAAAGGATGTTGG - Intergenic
959424553 3:106170033-106170055 ATGGCATAATGAAGGCAAGTTGG + Intergenic
959508603 3:107183138-107183160 TTGTCATTATGTAAGGAAAATGG - Intergenic
959870578 3:111322952-111322974 GGGTCATTTTGAAAGGAAGTTGG + Intronic
961119830 3:124364494-124364516 ATCTCCTAAGGAAAGGAAGTGGG + Intronic
964162592 3:153663294-153663316 TTTTTATTATGAAGGGAAGTTGG + Intergenic
964203284 3:154142032-154142054 ATGATATTTTGAAAGGATGTAGG + Intronic
965385555 3:168042064-168042086 ATGTCATCATGATGGGAAGCTGG - Intronic
965783892 3:172316299-172316321 ATGTCATCAAGAAAAGAAGCAGG - Intronic
967236677 3:187391718-187391740 CTGCCATTGTGAAGGGAAGTTGG - Intergenic
967607096 3:191459642-191459664 TTTTTATCATGAAAGGAAGTTGG - Intergenic
970725696 4:19041768-19041790 ATGTAATTGGGAAAGGAAGATGG - Intergenic
971121448 4:23709557-23709579 ATGTTATTAAGAAAGGAATTAGG - Intergenic
972064630 4:34925635-34925657 ATGTCATGGTGATAGGAGGTGGG + Intergenic
973680281 4:53310550-53310572 TTTTCATTATGAAAGCCAGTGGG + Intronic
975094959 4:70447042-70447064 ATGATATTATGGAAGGAATTGGG + Intronic
976266363 4:83189207-83189229 ATGCCAACAAGAAAGGAAGTGGG + Intergenic
976351807 4:84068258-84068280 ATCTAATTATTAAAGGAAGAGGG - Intergenic
976597564 4:86908271-86908293 AAGTGATGATGAAAGAAAGTGGG + Intronic
976856912 4:89614781-89614803 ATGGCATAATGAAAGGAGTTTGG - Intergenic
977536094 4:98258815-98258837 ATGTAATTAGATAAGGAAGTAGG + Intergenic
977915036 4:102582649-102582671 CTGTCATTGTGAATGAAAGTTGG + Intronic
979034511 4:115697574-115697596 TTGTTATTAGGAAAGGAAGAGGG + Intergenic
979841058 4:125441001-125441023 ATGTAATTATGAACTGAACTAGG - Intronic
980843058 4:138290076-138290098 ATGTGATTATATAATGAAGTTGG + Intergenic
981056314 4:140365761-140365783 ATGTTATTAAGAAAGTAAGAAGG - Intronic
981286302 4:143023220-143023242 ATGACCTTCTGAAAGGAAATAGG - Intergenic
983181042 4:164649575-164649597 ATGTCATTATAAAAGTAATGTGG + Intergenic
983262220 4:165469752-165469774 ATTTGATTATGACAGGCAGTAGG + Intronic
983768126 4:171512501-171512523 ATTTCATTGTGAAAGGAGGAAGG - Intergenic
983838010 4:172417197-172417219 TTTTCATTATGAAAGGATATTGG - Intronic
983863824 4:172739343-172739365 CTGTCCTTATGACAAGAAGTAGG - Intronic
984228208 4:177061815-177061837 ATGCCATTTTGAAAGAAACTGGG - Intergenic
984243532 4:177247388-177247410 ATTTTATTATGAAAGGAAGGAGG + Intronic
986866646 5:11996994-11997016 ATTTTATCATGAAAGGATGTTGG + Intergenic
987211781 5:15691212-15691234 ATGTCCTGATGAAAGGTGGTGGG - Intronic
987526717 5:19060285-19060307 ATATCATTAGTTAAGGAAGTGGG - Intergenic
988084355 5:26456070-26456092 ATTTAATAATGAAATGAAGTAGG + Intergenic
988637490 5:33001131-33001153 CTTTCATTATGAAGGGATGTTGG + Intergenic
992325053 5:75652227-75652249 ATGTGATGATGATAGGAGGTGGG - Intronic
992437043 5:76764459-76764481 CTTTTATTATGAAAGGATGTTGG + Intergenic
993002544 5:82396250-82396272 AAGTCAGTATCAAAGGAAGGAGG + Intergenic
994005514 5:94832651-94832673 AAGTCATTCTGAAGGGGAGTAGG - Intronic
994100926 5:95891989-95892011 ATTTTATTAAGAAAGTAAGTTGG - Intronic
995513336 5:112929562-112929584 GTCTCATCACGAAAGGAAGTGGG - Intergenic
995600999 5:113795981-113796003 ATGGCTGTATGAAAGGAAGAGGG + Intergenic
995772981 5:115691973-115691995 ATTTCATTAACAAAGGAACTGGG + Intergenic
995901990 5:117080569-117080591 CTCTAATTTTGAAAGGAAGTAGG + Intergenic
998255473 5:140583876-140583898 ATTTTCTTATGAAAGGATGTTGG - Intronic
1002888345 6:1314164-1314186 AAGTCCTTATGAAGGGAAGGAGG - Exonic
1002922694 6:1584309-1584331 ATGTCATTAAGTATGGAAGTGGG - Intergenic
1003172036 6:3727458-3727480 CTGTTCTTATGGAAGGAAGTGGG - Intronic
1003489648 6:6610237-6610259 ATGTTACCATGAAGGGAAGTGGG + Intronic
1004973561 6:20938933-20938955 ATGACAACATGAAAGGAAGAAGG - Intronic
1005036296 6:21558136-21558158 ATGTGATGATGTTAGGAAGTGGG + Intergenic
1008315635 6:50036755-50036777 AAGTCTTTATAAAAGGAAGATGG + Intergenic
1008683532 6:53899732-53899754 ATGTCATTGTTATAGGAAATAGG + Exonic
1010046005 6:71444359-71444381 GTGTTATTTTGTAAGGAAGTAGG - Intergenic
1010813762 6:80330314-80330336 ATGTCAGCAAGACAGGAAGTAGG - Intronic
1010923903 6:81720104-81720126 ATGAGATTAAGGAAGGAAGTAGG + Intronic
1012458443 6:99432211-99432233 CTGTCTTTATGAACAGAAGTGGG + Intergenic
1012473871 6:99600827-99600849 AAGTCATTATCAGAGGAAGCTGG - Intergenic
1012781698 6:103567657-103567679 ATGTCATTATAAAAGGGATTTGG + Intergenic
1012933923 6:105345765-105345787 ATGGCATTAGGAAAGCTAGTTGG + Intronic
1013883177 6:114929587-114929609 GTGTTATTATGAAAGGATGTTGG + Intergenic
1014331500 6:120071574-120071596 TTATCAATATGAAAGAAAGTAGG - Intergenic
1014677080 6:124379771-124379793 AAGACATTTTGAAAGGAACTTGG + Intronic
1014677757 6:124388568-124388590 TTGTATTTATAAAAGGAAGTAGG - Intronic
1014845187 6:126267278-126267300 ATGATATAATGAAAGGATGTAGG + Intergenic
1016178168 6:141106790-141106812 ATTTCATTATAAAATGATGTAGG + Intergenic
1017349523 6:153423254-153423276 CTGTCAGTAAGAAAGGAAGATGG - Intergenic
1018074337 6:160197728-160197750 ATGGCAATATGAATGGAACTGGG + Intronic
1018482726 6:164207884-164207906 ATGACATTTTAAAAAGAAGTTGG + Intergenic
1021815942 7:24447768-24447790 ATGTCCTTATCAAATGAAGTAGG + Intergenic
1022226247 7:28366899-28366921 GGGTAATCATGAAAGGAAGTTGG + Intronic
1022858129 7:34337164-34337186 TTTTCATCATGAAAGGATGTTGG + Intergenic
1022980050 7:35595808-35595830 ATGTCCTTAGGAAAGTGAGTAGG + Intergenic
1023470936 7:40518451-40518473 ATGTCATTAATAAACCAAGTGGG + Intronic
1023658884 7:42453414-42453436 ATGTCTTTACAAAAGGAAGATGG + Intergenic
1023910805 7:44554982-44555004 GTTTTATTATGAAAGGATGTCGG - Intergenic
1024181964 7:46904955-46904977 TTGTTATTATGAAAGGTTGTTGG - Intergenic
1024521116 7:50304664-50304686 AAGTCATTGTGAAAGAAAGCTGG + Intronic
1024586584 7:50847056-50847078 ATGTCATTGTGAGAGGATGGGGG + Intergenic
1025010134 7:55390131-55390153 ATTTCATTATGAAACTGAGTCGG + Intronic
1028020225 7:85761962-85761984 ATGTCATTTTGAAAAGAAAGAGG + Intergenic
1028162306 7:87499240-87499262 ATGTCATCATGGAAGAAAGTTGG - Intergenic
1028617573 7:92786276-92786298 ATGTGATTATGAAAGGTTTTTGG - Intronic
1028689302 7:93633714-93633736 AAGTCATTTTGAAAGTAAGCAGG + Intronic
1030188922 7:106791451-106791473 ATGCCAGGATGAAAGGATGTCGG + Intergenic
1031211045 7:118826608-118826630 ACCTCATTCTGAAAGGAAGTTGG + Intergenic
1031513023 7:122672218-122672240 CTGTTGTTATGAAAGGATGTAGG - Intronic
1032760538 7:134937068-134937090 ATGTCTTTATAGAAAGAAGTGGG + Intronic
1033231571 7:139602462-139602484 ATGTCAAAACGAAAGGAAGGAGG + Intronic
1037805120 8:22054689-22054711 AGAGCCTTATGAAAGGAAGTGGG + Intronic
1039194937 8:35020456-35020478 TTGTCATTATGAGGGGGAGTGGG - Intergenic
1040768856 8:50949495-50949517 ATGTCCTGGTGAGAGGAAGTTGG + Intergenic
1041058269 8:54010168-54010190 ATCTCACTGTGAGAGGAAGTTGG - Intronic
1042963187 8:74323885-74323907 CTTTCTTTATGAAAGAAAGTTGG + Intronic
1043021955 8:75013067-75013089 ATGTAACTATGAAAGAAATTAGG + Intronic
1045960816 8:107965895-107965917 ATGTAACTATCAAAGGAAGGCGG + Intronic
1046071871 8:109265501-109265523 ATGTCATTATGAAAGGAAGTAGG - Intronic
1046137637 8:110050410-110050432 ATGTCACAATGATAGGAATTAGG + Intergenic
1047029303 8:120859692-120859714 ATGTCACTATGAAGGGAAGTTGG + Intergenic
1047073063 8:121369458-121369480 ATGTCTTTCAGAAATGAAGTGGG - Intergenic
1047440852 8:124877001-124877023 TTTTCATCATGAAAGGATGTTGG + Intergenic
1047839158 8:128730388-128730410 TTGTTATCATGAAAGGATGTTGG + Intergenic
1047846940 8:128816384-128816406 ATGACAATATGAAAGGAACCTGG + Intergenic
1048061947 8:130928469-130928491 TTTTCATCATGAAAGGATGTTGG + Intronic
1050113312 9:2239105-2239127 ATGTTATTATGTATAGAAGTAGG - Intergenic
1050280752 9:4047684-4047706 ATGTCAGTATGAAAAGAGGTGGG + Intronic
1050310561 9:4348610-4348632 ATCTTATTATGAAAGAAGGTGGG + Intergenic
1051679345 9:19591406-19591428 ATGTCATTAGGAAATGAAAATGG - Intronic
1051839853 9:21383402-21383424 ATGGGATTAGGAAAGGATGTGGG - Intergenic
1052472922 9:28922929-28922951 ATGTCTTTATAAAAGGGAGGTGG + Intergenic
1052527926 9:29644790-29644812 TTGTCATTATAAAAGTAAATTGG - Intergenic
1052564080 9:30124245-30124267 ATGTCCTTATGAAAGAAACATGG - Intergenic
1052671908 9:31568753-31568775 AGGTCATGATATAAGGAAGTGGG + Intergenic
1055574767 9:77649447-77649469 GTGTCATTATATAAAGAAGTTGG + Intergenic
1055716978 9:79128512-79128534 ATGTTAGTATGGAAGGAAGCTGG - Intergenic
1055864007 9:80790298-80790320 AAGTAATTGTGAAAGAAAGTTGG - Intergenic
1057760153 9:97866380-97866402 TTTTCATCATGAAAGGATGTTGG + Intergenic
1057958069 9:99427552-99427574 ATGTGATTATGTTAGGAAGATGG + Intergenic
1058479738 9:105379467-105379489 ATGTTATCATTGAAGGAAGTTGG + Intronic
1058850529 9:109007586-109007608 AAGTGATTATTAAAGGAGGTGGG + Intronic
1060614585 9:125000347-125000369 ATATTATTTTAAAAGGAAGTTGG + Intronic
1060628849 9:125138114-125138136 TTCTCATTTTGAAAAGAAGTGGG + Intronic
1203489940 Un_GL000224v1:95324-95346 ATTTCATCATGAAAGGATGTTGG - Intergenic
1203502563 Un_KI270741v1:37210-37232 ATTTCATCATGAAAGGATGTTGG - Intergenic
1185915689 X:4032820-4032842 ATGTGATTTTAAAAGGAACTAGG - Intergenic
1186314292 X:8351930-8351952 ATGACACTATGAAATGAAGCTGG - Intergenic
1187013183 X:15300741-15300763 ATGTCAATATTAAAGGAAGTTGG + Intronic
1187077071 X:15945989-15946011 ATAACACTATGAAATGAAGTGGG - Intergenic
1187724745 X:22190781-22190803 AGGCCATTATGAAAGGAAAGTGG - Intronic
1187794992 X:22994158-22994180 ATGACATTAATGAAGGAAGTGGG - Intergenic
1189578172 X:42377299-42377321 ATTTCATTGGGAAATGAAGTAGG + Intergenic
1190153631 X:47969135-47969157 ATGTCTTTCTTAAAGGAAGTGGG + Intronic
1194758040 X:97760791-97760813 ATGTTATTTTGAAAGGCATTTGG + Intergenic
1194893492 X:99408942-99408964 ATGTGATTAAGAAAAGAATTTGG - Intergenic
1196894953 X:120326172-120326194 TTTTTATTATGAAAGGATGTTGG + Intergenic
1198378841 X:136065342-136065364 ATGTCATTCTGAAATGCAGTGGG - Intergenic
1199289833 X:146093404-146093426 ATGCCATTCTGAAACGAAGCAGG + Intergenic
1199670208 X:150139682-150139704 ATGACATTAGGAATGGAAGAGGG - Intergenic
1199799475 X:151235349-151235371 CTGCCATTATGAGATGAAGTGGG - Intergenic
1200987553 Y:9319840-9319862 ATGTTATTATGAAATTAATTAGG - Intergenic
1201059330 Y:10031238-10031260 ATGTTATTATGAAATTAATTAGG - Intergenic
1201187934 Y:11422003-11422025 GTGACCTTAGGAAAGGAAGTAGG - Intergenic
1201416809 Y:13755198-13755220 ATGTCATACAGAAAGGAAGATGG + Intergenic
1202120484 Y:21516358-21516380 ATGTTATTATGAAATTAATTAGG + Intronic
1202122935 Y:21539899-21539921 ATGTTATTATGAAATTAATTAGG + Intronic
1202156070 Y:21889482-21889504 ATGTTATTATGAAATTAATTAGG - Intronic
1202158518 Y:21913023-21913045 ATGTTATTATGAAATTAATTAGG - Intronic
1202184971 Y:22177948-22177970 ATGTTATTATGAAATTAATTAGG - Intronic
1202197904 Y:22313795-22313817 ATGTTATTATGAAATTAATTAGG + Intronic
1202206389 Y:22408453-22408475 ATGTTATTATGAAATTAATTAGG + Intronic