ID: 1046072766

View in Genome Browser
Species Human (GRCh38)
Location 8:109278566-109278588
Sequence ACTTGTTATCTCTAGGGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046072766 Original CRISPR ACTTGTTATCTCTAGGGTGT AGG (reversed) Intronic
902255288 1:15185052-15185074 AGTAGTTATCTTTGGGGTGTGGG - Intronic
904536074 1:31200347-31200369 AGATGTTATTTCTAGGGAGTGGG + Intronic
904536587 1:31203502-31203524 ATTTGTTAACTCTAGGGAATGGG + Intronic
904992354 1:34603389-34603411 TCTGGGTATCTCTAGGATGTGGG - Intergenic
906231223 1:44166215-44166237 ACTTGTAATATCAAGGCTGTAGG - Intergenic
907793838 1:57694556-57694578 ACTAGTTATCTCTGGAGAGTTGG + Intronic
908217404 1:61968080-61968102 ACTTGTTTTCTCTCCGGTGTTGG - Intronic
911754703 1:101539660-101539682 ACCTCTTATCTCTACCGTGTTGG - Intergenic
916773875 1:167939302-167939324 AATTGTTATATTTAAGGTGTAGG + Intronic
917990797 1:180376687-180376709 ACTGGTTACCTGTAGGGAGTGGG + Intronic
919557417 1:199076043-199076065 ACTTCTTATCTTCAGGGTCTTGG - Intergenic
923862026 1:237900805-237900827 ACTTTTTATCCCTAGAATGTTGG - Intergenic
1062898463 10:1123051-1123073 ACTTTTCATCTTTAGGGCGTGGG + Intronic
1063123411 10:3120522-3120544 ATTTGTTATCTCTCTGGTCTTGG + Intronic
1067291974 10:44950237-44950259 ACTTTTTATCTGCATGGTGTTGG - Intergenic
1068024049 10:51620370-51620392 ACTTGGTATCTTTAGTGTCTAGG - Intronic
1068779191 10:60901217-60901239 ACTTATTCTCTCTAGGCTGAGGG + Intronic
1071668904 10:87588928-87588950 ATTTGTCTTCTCTAGGGAGTGGG - Intergenic
1071827963 10:89344010-89344032 ACTTAGTATCTCTACAGTGTTGG + Intronic
1072237969 10:93469497-93469519 TCTTGTTTGCCCTAGGGTGTTGG - Intronic
1077118539 11:896361-896383 GCTTGTTGTGTCTAGGGTGGAGG - Intronic
1077324985 11:1959810-1959832 ACTTGCTATCTCTTGGGTCAGGG - Intronic
1078629815 11:12992123-12992145 ATTTGTTATCTCCAGATTGTTGG + Intergenic
1079758301 11:24295058-24295080 ACTTGTTAGCTGTAGGAAGTTGG - Intergenic
1081306164 11:41514731-41514753 CCTTGGTTTCTCTAGGGTGCTGG + Intergenic
1082896751 11:58200127-58200149 ACCTCTTATCTCTGGCGTGTAGG - Intergenic
1084142290 11:67240617-67240639 TCCTGTGATCTGTAGGGTGTGGG + Intronic
1088912317 11:114200915-114200937 CCTTGTTTTTTCTAGGATGTTGG + Intronic
1089796975 11:120988663-120988685 ACTTTTTATCTGTTGGTTGTTGG + Exonic
1202807967 11_KI270721v1_random:14989-15011 ACTTGCTATCTCTTGGGTCAGGG - Intergenic
1094415723 12:30212902-30212924 ACTTGGTAACTCTGGGGTGTGGG + Intergenic
1099766204 12:86989061-86989083 ATTTTTTATCCCTAGGGTTTGGG - Intergenic
1100096393 12:91043161-91043183 AACTGTTATTTCTAGGGAGTAGG + Intergenic
1100469753 12:94879951-94879973 ACTTGTTATCTGTATGATTTTGG - Intergenic
1101942520 12:109110598-109110620 TCTTGTTATTCCTTGGGTGTTGG + Exonic
1102235364 12:111291212-111291234 ACCTGCTATCTCCAGGGTATGGG - Intronic
1102910533 12:116710280-116710302 AGTGGTTATCTCTAGGGGCTGGG + Exonic
1103657346 12:122483556-122483578 ACTTGTTTTCTGCAGGTTGTAGG - Exonic
1104279596 12:127362762-127362784 ACTTGAGATGTCTATGGTGTTGG + Intergenic
1104561757 12:129852152-129852174 ACCTGTTACTTCTAGGGTCTGGG + Intronic
1106480984 13:30136589-30136611 ACTTGTTATCTGTAAGATCTTGG - Intergenic
1107535811 13:41330000-41330022 GCTTGTTATATCTAGGGTAGTGG + Intronic
1110897810 13:80777686-80777708 ATTTGTTATCCCTAGGAGGTGGG - Intergenic
1111903185 13:94225111-94225133 AGTTGAGATGTCTAGGGTGTCGG + Intronic
1111968779 13:94888508-94888530 AATAGTTATCTCTAGGGAGGTGG - Intergenic
1113608334 13:111626136-111626158 CCTTGTGATCGCTAGCGTGTTGG + Intronic
1116922562 14:50595261-50595283 ACTTTTTATATCTAGAATGTGGG - Intronic
1117550352 14:56829917-56829939 ACTTATTATGTCTAGAGGGTGGG + Intergenic
1119701547 14:76759092-76759114 ACTTGTTCTCTCTGGGCTTTTGG + Intergenic
1125861926 15:43007650-43007672 AGTAGGTATCTCTAGGTTGTGGG - Intronic
1126719609 15:51563701-51563723 ACATGTTATATTTAGGATGTTGG - Intronic
1132425267 15:101710598-101710620 AATTCTTATCTCAAAGGTGTGGG - Intronic
1136396588 16:29995768-29995790 ACTTGTTTTCTCTGGGCAGTTGG + Exonic
1141195941 16:81861368-81861390 ACTTGTTAGCTTCAGGGTTTGGG + Intronic
1141941983 16:87283088-87283110 ACTTGTTATCTCAATGCTTTTGG + Intronic
1143322957 17:6079958-6079980 ATATGATATCTCTAGGTTGTTGG + Intronic
1143519900 17:7439181-7439203 TCTTGTAATCTACAGGGTGTGGG - Exonic
1146111722 17:30095666-30095688 ACTTGTTATTTCTGGATTGTCGG - Intronic
1146652936 17:34617926-34617948 GGTGGTTATCTCTAGGGGGTGGG - Intronic
1147293938 17:39465874-39465896 AATTGTTAACTTTAGGGTATGGG + Intronic
1148327795 17:46793927-46793949 ACTGGTTATCTCCAGAGGGTGGG - Intronic
1150485386 17:65539563-65539585 ACTTGTTATCTGTAGAGGGAGGG + Intronic
1154295846 18:13146853-13146875 AATTGTTATTTCTAGGATGAGGG + Intergenic
1155134050 18:22969959-22969981 CCTTGTCATCTGTAGGGTATTGG + Intronic
1157174651 18:45440378-45440400 ACTTCTCATCTCTATGGTCTTGG - Intronic
1159480562 18:68985920-68985942 AATTGTAATCACTAGTGTGTTGG + Intronic
1159732250 18:72043184-72043206 ACTTGTTATCTATATGGTCATGG - Intergenic
1162254560 19:9478765-9478787 ACTTTTTATCTTTTGTGTGTTGG - Intronic
1164761703 19:30733105-30733127 ACCTGTTATCTATGGGGTGCAGG - Intergenic
1166428583 19:42701861-42701883 ACTTGACATTTCTAGTGTGTGGG - Intronic
925598153 2:5578166-5578188 CCTTTTTATTTCTAGGGTGTTGG - Intergenic
926183421 2:10666849-10666871 AAGTGTTACCTCTGGGGTGTAGG + Intronic
928613852 2:33017080-33017102 ACTTATTATAACTAAGGTGTTGG - Intronic
930315286 2:49789972-49789994 ACTTATTATCCATAGGATGTTGG + Intergenic
930949159 2:57116293-57116315 AATTGTTATATGTAGGCTGTTGG + Intergenic
931153788 2:59604598-59604620 ACTTTTTATGTCAAGGGAGTGGG + Intergenic
931969014 2:67565637-67565659 TCTTCTTTTCTGTAGGGTGTTGG - Intergenic
932962486 2:76430333-76430355 CCTTGTTACCTCTCGTGTGTGGG - Intergenic
934092370 2:88563420-88563442 ACTTCTTATCCCTGGGGTTTTGG + Intronic
937065125 2:119011818-119011840 ATTTGTTATTACTAGGGGGTCGG - Intergenic
937671901 2:124547086-124547108 ATTTGCTATCTCTAGGGTTTTGG - Intronic
939785657 2:146508293-146508315 ACTTATTATCTGTAGAGTCTTGG - Intergenic
940230157 2:151442633-151442655 ACTTAGTATCTCTAGGATATAGG + Intronic
940749014 2:157602801-157602823 AGTTGTTATCTCTGAGGTATGGG + Intronic
947468646 2:230379401-230379423 CCTTGTCATCTCTGGGGTTTGGG - Intronic
948193383 2:236077168-236077190 ACTGATTATCTCTCGGGGGTTGG - Intronic
1172134424 20:32677378-32677400 TCTTGGTATCTCCAGGATGTAGG + Intergenic
1174678488 20:52381069-52381091 ACCTGTTATCTGTAGAGTGAGGG + Intergenic
1174939694 20:54912230-54912252 TATTGTTTTGTCTAGGGTGTGGG - Intergenic
1179402955 21:41101270-41101292 TATTGTTATCACTAGAGTGTAGG - Intergenic
1184937993 22:47739249-47739271 ACTTGTTAGCTGTGGGGTCTTGG - Intergenic
1185162222 22:49236915-49236937 ACTGGAAATCTCTAGGGGGTGGG - Intergenic
949911335 3:8910912-8910934 AGTTGTTACCTCTAGGGAATGGG + Intronic
955555750 3:60135406-60135428 ATTTGTTAGCTCCAGGGTGTAGG - Intronic
956300706 3:67769705-67769727 ACTTGTGATCTTTTGGGTTTGGG - Intergenic
960641702 3:119831153-119831175 ACTTGTTAGCTATATGGTCTTGG - Intronic
960740337 3:120826310-120826332 ACTTGTTATTTTTTGAGTGTGGG + Intergenic
960815826 3:121671356-121671378 CCTTGTTATCTATGGGGTATTGG + Intronic
967581232 3:191157431-191157453 ACTTGAGATGTCTATGGTGTTGG + Intergenic
971641509 4:29138988-29139010 ACTTCTTATCTCTATGTTATGGG + Intergenic
974874358 4:67685137-67685159 ACTAGTTATCTTTGGGGAGTGGG - Intronic
981137051 4:141221909-141221931 ACTTGTTATACTTAAGGTGTTGG + Intronic
982520492 4:156410400-156410422 AATTTTTATTTCTATGGTGTGGG + Intergenic
982561112 4:156928869-156928891 ACTGTTTATCTCTATGATGTTGG + Intronic
983350764 4:166585295-166585317 GCCTGCTATCTTTAGGGTGTAGG + Intergenic
984146238 4:176065224-176065246 GCTTATTCTCTCTAGTGTGTTGG + Intergenic
984476464 4:180241680-180241702 ACTTGCCATCTCAAGGCTGTAGG + Intergenic
988907542 5:35804601-35804623 ATTTTTGATCTCTAGGGGGTTGG - Intronic
988929776 5:36026429-36026451 ACTGGTTATCTCCAGGGGCTGGG - Intergenic
989112603 5:37921230-37921252 AGTGGTTATCTCTAGGATGGGGG - Intergenic
990753389 5:59041308-59041330 GTTTGTGATCTTTAGGGTGTGGG - Intronic
993993889 5:94695784-94695806 ATTTCTTCTCTCTAGGTTGTTGG + Exonic
997877476 5:137562260-137562282 ACTGGTTAGCTCTGGGTTGTGGG + Intronic
1000841244 5:166221095-166221117 ACTTGTTAACTCTAGCTGGTGGG + Intergenic
1001760904 5:174207374-174207396 ACTTATTATCTCTAAGGCCTTGG - Intronic
1002367002 5:178721106-178721128 AATGGTTATCTCTAAGGTGAAGG - Intronic
1003584897 6:7379662-7379684 ACTGGTTATCTCTGGGGAGGAGG - Intronic
1008451413 6:51655649-51655671 ATGTGTTATCTCCAGGGAGTGGG + Intronic
1008639803 6:53450163-53450185 ACTTGGTATCTCTGGGGTGTGGG + Intergenic
1010034216 6:71303290-71303312 CCTTGATATCTGTAGGGGGTTGG - Exonic
1010624856 6:78125532-78125554 ACTTGGTATCTGTAGGATATTGG + Intergenic
1012972389 6:105745456-105745478 AGTTGTAATCTCAAGGCTGTAGG - Intergenic
1014501607 6:122197507-122197529 ACTAGCTATGTGTAGGGTGTGGG - Intergenic
1017299487 6:152839448-152839470 AATTGAGATGTCTAGGGTGTTGG + Intergenic
1017534449 6:155331247-155331269 ACTTGCTATCTCTGTGATGTGGG + Intergenic
1017860937 6:158396683-158396705 ACTGGTTATTTCTAGGAAGTGGG - Intronic
1018173578 6:161160934-161160956 ACCTATTATCTATAGGGTGCTGG - Intronic
1019381294 7:725540-725562 CCTTGTTATTTCTTGGGAGTAGG + Intronic
1021679151 7:23112199-23112221 ACTTATGATCTCTAGGGTTCTGG + Intronic
1026847340 7:73705472-73705494 ATCTGTTATCTCCAGGGGGTGGG - Intronic
1029788184 7:102814468-102814490 AACTGTTATCTCTATGTTGTTGG - Intronic
1032370146 7:131340886-131340908 ATTGGTTATATCTAGGGTGGAGG + Intronic
1032443252 7:131958682-131958704 ACTTCTTATGTCCAGGATGTAGG + Intergenic
1032787634 7:135213092-135213114 ACTTGGTATCTGCAGGGGGTTGG - Intergenic
1035544876 8:472533-472555 CCTTGTGATCTCTTGGGTTTTGG + Intergenic
1036275006 8:7343131-7343153 AGTTCTTATCTCTGGGGGGTAGG - Intergenic
1036346348 8:7967217-7967239 AGTTCTTATCTCTGGGGGGTAGG + Intergenic
1036841670 8:12127975-12127997 AGTTCTTATCTCTGGGGGGTAGG + Intergenic
1036863485 8:12374222-12374244 AGTTCTTATCTCTGGGGGGTAGG + Intergenic
1041309412 8:56499530-56499552 ACTTGAGATATCTATGGTGTTGG + Intergenic
1041773531 8:61498366-61498388 ACTTGTAATGTGTAGGGTTTGGG + Intronic
1043164033 8:76880761-76880783 ACTTGTTATCCCTAGCATGGAGG - Intergenic
1044662504 8:94605406-94605428 ACTTGAAATCTCTTGGCTGTGGG + Intergenic
1046072766 8:109278566-109278588 ACTTGTTATCTCTAGGGTGTAGG - Intronic
1050931529 9:11334252-11334274 ACTGGTTACCTTTAGGGTATAGG + Intergenic
1055813849 9:80182093-80182115 AGTAGTTATCTCTAGGTTGGAGG - Intergenic
1061458767 9:130719105-130719127 AATTTTTATCTCTAGGGACTTGG + Intronic
1185854594 X:3522499-3522521 AATCGTTATCTCCAGGGTGTTGG + Intergenic
1187581148 X:20608733-20608755 ACTAGCAATCTCTAGGTTGTGGG + Intergenic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic
1193660318 X:84249292-84249314 ACTAATCATCTCTAAGGTGTAGG + Intergenic
1194161709 X:90461510-90461532 ATTTGTGATCTCTGGGTTGTGGG - Intergenic
1198437244 X:136629241-136629263 AGTGGTTATCTTTAGGTTGTGGG + Intergenic
1199715384 X:150504028-150504050 ACTTCCTGCCTCTAGGGTGTGGG - Intronic
1199911030 X:152287226-152287248 TCTTCTTATCTGTAGGATGTTGG - Intronic
1200507992 Y:4039243-4039265 ATTTGTGATCTCTGGGTTGTGGG - Intergenic
1201340733 Y:12930572-12930594 ACTGGTTATCTCCAGGATATGGG + Intergenic