ID: 1046073640

View in Genome Browser
Species Human (GRCh38)
Location 8:109289273-109289295
Sequence ATGTTTTAGCATGAAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 261}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046073640 Original CRISPR ATGTTTTAGCATGAAAAGAC TGG (reversed) Intronic
907182188 1:52580457-52580479 ATATATTAGCATTAAAAAACTGG - Intergenic
908141586 1:61190475-61190497 CTGTTTTAGAAGGAAAATACTGG - Intronic
910027187 1:82669606-82669628 ATTTTCTAGCAGGAAAAGGCTGG + Intergenic
911028686 1:93462649-93462671 ATGTTTTTTCATGATTAGACTGG + Intronic
911121537 1:94301891-94301913 CTGTTTTATCATGAGAAAACTGG - Intergenic
911971780 1:104447926-104447948 AAGTTTTAGGATGAAAATATAGG + Intergenic
913049987 1:115109119-115109141 ATGTTGTAGCATCAAAAGAAAGG - Intergenic
913523980 1:119673584-119673606 TTGTTTTATCTTGAAAAGATAGG - Intronic
914384858 1:147158779-147158801 ATGTTTCAGCATTATAAGAAAGG - Exonic
914427944 1:147595984-147596006 AGGTTTGAGCATGAAAACAAAGG + Intronic
919563944 1:199160482-199160504 ATGTAATAGCATTACAAGACAGG + Intergenic
920104488 1:203542108-203542130 ATGTTTTAAAATGATCAGACTGG + Intergenic
920284812 1:204871743-204871765 TTGGTTTAGCATGAAGTGACAGG - Intronic
921445383 1:215240705-215240727 TTGTTTAAGCATGAAAAAGCTGG - Intergenic
921640068 1:217542691-217542713 ATGTCTCAGCATAATAAGACTGG + Intronic
923389268 1:233497913-233497935 ATGTTTAAGCATGTAGAGGCTGG + Intergenic
923676767 1:236087134-236087156 ATGTTTAAACATCAAAATACAGG + Intergenic
1063068474 10:2634758-2634780 ATGTTTTATAAATAAAAGACTGG - Intergenic
1063840516 10:10066438-10066460 GTGTGTTAAGATGAAAAGACAGG - Intergenic
1068097699 10:52512444-52512466 ATGTTTTAGAATGAAAAATCTGG - Intergenic
1068190073 10:53639955-53639977 ATTTTTTTTCATGATAAGACAGG - Intergenic
1069229692 10:65994247-65994269 ATCTATTATCATGAAAACACAGG - Intronic
1070394209 10:75997960-75997982 ATGTTTTAGGTTAAAAAGAAAGG - Intronic
1072561338 10:96578157-96578179 ATGTTTGAAAATGAAATGACTGG - Intronic
1074324322 10:112433425-112433447 TTGTTTTAGCATGGAAAAAAAGG + Intronic
1076138178 10:128059061-128059083 ACTTTTTAGAATAAAAAGACAGG + Intronic
1076455127 10:130587147-130587169 AAGTTTCAGAATGCAAAGACTGG - Intergenic
1077748900 11:4941287-4941309 ATGATTTACACTGAAAAGACAGG - Intronic
1079270179 11:18977045-18977067 ATCTTGTTTCATGAAAAGACAGG - Intergenic
1080019168 11:27541546-27541568 CTGTATAAGAATGAAAAGACAGG + Intergenic
1080800148 11:35602850-35602872 CTGTCTTGGCATGACAAGACAGG - Intergenic
1081904589 11:46659867-46659889 ATTATTTAGCATAAAATGACAGG + Intronic
1085064970 11:73486513-73486535 ATGTTAAAGCATGAAAATGCTGG + Intronic
1087715738 11:101606806-101606828 AAATTTTAGCATGAAAATATAGG + Intronic
1088036118 11:105318278-105318300 CTTTTTTTGCATGGAAAGACAGG + Intergenic
1088124128 11:106403685-106403707 ATGTTTTCTCATGATTAGACTGG + Intergenic
1088445171 11:109918612-109918634 ATTATTCAGCATGAAAAGATAGG - Intergenic
1089709298 11:120303347-120303369 ATATTTTGGCATGGAGAGACTGG + Intronic
1092495206 12:8986597-8986619 ATTTTTTAACATTAAAAGACTGG + Intronic
1092684160 12:11022878-11022900 ATGTGTTAGTATGCAAAGAAAGG + Intronic
1093451571 12:19321838-19321860 ATGTTTCAAAATGAAAACACTGG - Intronic
1094119269 12:26951827-26951849 ATGTTTTAGTGTGTAAAGAAGGG + Intronic
1098215012 12:68206553-68206575 ATGTTGTACAATGGAAAGACTGG + Intronic
1098449736 12:70606538-70606560 TTGTTTTAGACTGATAAGACAGG + Intronic
1099338930 12:81402533-81402555 ATGTTTTATCAAGAAATGTCAGG + Intronic
1100093061 12:90995498-90995520 CTCCTTTAGCATTAAAAGACTGG + Intronic
1100621799 12:96283790-96283812 CTGTTTTAGTCTTAAAAGACTGG + Intronic
1101915395 12:108892011-108892033 ATGTTTTTCCTGGAAAAGACTGG - Intronic
1103232513 12:119343711-119343733 AAGTTCTATCATGGAAAGACAGG + Intronic
1104610074 12:130220449-130220471 ATGTAATAGCATTAAAAGCCAGG - Intergenic
1106186946 13:27417969-27417991 ATTTTGTGGCATGAAAAGCCTGG + Intergenic
1106740019 13:32630754-32630776 CTGTTTTAGCTTGCAAAGACTGG - Intronic
1108829506 13:54459893-54459915 ATGTTCTAGTATGAATAGAATGG + Intergenic
1109951512 13:69506666-69506688 ATGTATTAGCCTCTAAAGACAGG - Intergenic
1110129945 13:71995322-71995344 ATATTCTAGCATGAATAGAAGGG - Intergenic
1111349457 13:87007255-87007277 ATATTTTAGCAAGAAAAAAAGGG + Intergenic
1113003260 13:105668498-105668520 ATTTTTTACCATGATTAGACTGG - Intergenic
1114489347 14:23088338-23088360 ATCTTTTAGTAAGAAAATACTGG - Intronic
1114840068 14:26252661-26252683 ATGCATCCGCATGAAAAGACAGG + Intergenic
1114862888 14:26548121-26548143 ATGTTTTAGAATCAATAGAGGGG - Intronic
1114994930 14:28337044-28337066 ATGATTTATTCTGAAAAGACAGG - Intergenic
1115072968 14:29348555-29348577 AGGTTTTAGCCTAAAGAGACTGG + Intergenic
1115780391 14:36762318-36762340 ATTTTTTTGCATGAGGAGACTGG + Intronic
1115874608 14:37846354-37846376 TTGTTTTAGCATGAGCAGAAGGG - Intronic
1116589453 14:46752277-46752299 ATATTTTAACATGAAAACATTGG + Intergenic
1117525422 14:56597568-56597590 ATGTTTTATCATTAAAGGAGAGG + Intronic
1117585088 14:57193255-57193277 ATATTTAAGCATGAAAAGTATGG + Intergenic
1117774836 14:59173003-59173025 ATTTTTATGTATGAAAAGACTGG + Intergenic
1118904770 14:70015853-70015875 CTGTTTTTGCATGAAACAACAGG - Intronic
1120278656 14:82410959-82410981 CTGTTTTACCAGGAAAAGACTGG + Intergenic
1120654744 14:87176516-87176538 ATTTTATAGAATGAAAAAACAGG - Intergenic
1120688155 14:87563038-87563060 ATGTTTTAGCAAAGAGAGACTGG + Intergenic
1122591374 14:102854258-102854280 AAGTTTTTGCGTGAACAGACTGG + Intronic
1123927293 15:25128992-25129014 TTGTTTTACAATCAAAAGACCGG + Intergenic
1124867574 15:33508305-33508327 ATATTTTAGCATCCAAAGTCAGG - Intronic
1126037171 15:44557378-44557400 CTGCTTTAGAATGAAACGACAGG + Intronic
1127133960 15:55899530-55899552 ATGTTTAAGCAAGAAAATACTGG - Intronic
1129050256 15:72775277-72775299 ATGTATTAGCATCAGAACACAGG + Intronic
1129139854 15:73587762-73587784 ATGTTTTAGGATGCACAGAGAGG - Intronic
1131325837 15:91443770-91443792 ATGTTTTAGCAACAAAAAATTGG + Intergenic
1135420450 16:22302329-22302351 CTGTTTTATAATGAACAGACTGG - Intronic
1137438682 16:48480076-48480098 ATGTTTTCTCATGATTAGACAGG + Intergenic
1137501321 16:49013634-49013656 CTGTTTTAGCAACAAAAGAGTGG + Intergenic
1140177129 16:72673598-72673620 ATATTTTCAGATGAAAAGACTGG + Intergenic
1140525572 16:75620022-75620044 TGGTTTGAGCATGAAAATACTGG + Intronic
1140548280 16:75834027-75834049 ATTTTTTATCATGAAAAGATTGG - Intergenic
1140629609 16:76835481-76835503 ATGTTTTCCCATGATTAGACTGG + Intergenic
1142773505 17:2117498-2117520 ATATTCTAGCAGCAAAAGACTGG + Intronic
1143207842 17:5158005-5158027 AGATTTTGGCAAGAAAAGACAGG + Intronic
1143812828 17:9486363-9486385 ATATTTGAGCATCAAAAGAATGG + Intronic
1144734206 17:17545935-17545957 AGATTTTAGCAGGAAGAGACAGG - Intronic
1145092361 17:19996533-19996555 ACCTTTGAGCATGAAAAGTCTGG + Intergenic
1149294238 17:55247315-55247337 ATGTTTTAGGAAGAAAAACCAGG + Intergenic
1149771034 17:59321148-59321170 ATGTTTTACTATTAAAAGAATGG + Intergenic
1149872527 17:60195888-60195910 AGATTTTGGCAAGAAAAGACAGG - Intronic
1151021868 17:70626363-70626385 ATGGTTTTGCATAAAAAGACTGG + Intergenic
1151182395 17:72338761-72338783 ATGTTTTAGCAGGAAAGGGAAGG - Intergenic
1151861888 17:76770428-76770450 ATATTTTAGGAGGAAAAGTCGGG - Intronic
1154017451 18:10631762-10631784 ATTTTTCCTCATGAAAAGACAGG + Intergenic
1154187410 18:12197833-12197855 ATTTTTCCTCATGAAAAGACAGG - Intergenic
1155335561 18:24761435-24761457 ATGTTATTGCAAGTAAAGACAGG - Intergenic
1156064978 18:33129580-33129602 AAGTTTTAGCATTAACAGATGGG - Intronic
1156264645 18:35476172-35476194 ATGTTTTCTCATGATAAAACTGG - Intronic
1158742649 18:60161510-60161532 ATTTTTTAGAAAAAAAAGACTGG - Intergenic
1161690092 19:5727273-5727295 TTGTTGTAGGATGAAAATACAGG - Exonic
1162591628 19:11596122-11596144 ATGTATTAGTATTAAAAGGCAGG - Intronic
1162614276 19:11784743-11784765 ATGTATTAGTATAAAAAGTCAGG - Intergenic
1164784077 19:30915795-30915817 ATGTTTTATTATGAAAAAAGTGG - Intergenic
1166251914 19:41577140-41577162 ATGCATTGGCATGGAAAGACGGG - Intronic
1166869238 19:45861230-45861252 ATGTATTATCATGAAAAAAGTGG - Intronic
926019216 2:9480581-9480603 ATGTATCTTCATGAAAAGACCGG + Intronic
926181077 2:10643841-10643863 ATGTTTGAGCATGAATTGACTGG + Intronic
926426708 2:12744827-12744849 ATGTGATAGCATTAAAAGGCAGG + Intergenic
927234028 2:20853383-20853405 ATATTTTAGAATGGAAAGAAAGG + Intergenic
928884914 2:36137288-36137310 ATGTTTTCTCATGATTAGACTGG - Intergenic
928986475 2:37186907-37186929 ATGGTTTACTAGGAAAAGACTGG + Intronic
928991877 2:37241022-37241044 ATTTTTTAGCCTTAAAAGATTGG + Intronic
929023758 2:37579175-37579197 ATGTGTTGGCATTAAAAGGCAGG - Intergenic
931036945 2:58254385-58254407 ATGTTTTAAATAGAAAAGACTGG - Intergenic
931606739 2:64060417-64060439 ATGTTCTAGTATGAAAATTCTGG + Intergenic
932298332 2:70645085-70645107 ATGTTATATCATGAGAAGGCAGG - Intronic
933009417 2:77040043-77040065 ATGTTGTAGCATTATAAGACAGG + Intronic
933055750 2:77662089-77662111 ATTTTTTAGAATGAATATACGGG + Intergenic
935677569 2:105609210-105609232 ATGTATAAGCATGAAAAGGGGGG + Intergenic
936226297 2:110656509-110656531 ATGTTTTCTCATGATTAGACTGG + Intronic
936807420 2:116352766-116352788 ATTTTCTAGCATGAATAAACAGG - Intergenic
938594234 2:132770305-132770327 ATCTTATAGAATTAAAAGACTGG - Intronic
939553870 2:143650285-143650307 ATGGTTTACCAAGAAAAGAGTGG + Intronic
940637200 2:156312534-156312556 ATGTTTCAGAAGGACAAGACAGG + Intergenic
940994088 2:160128488-160128510 ATTTTTTAGCATCAGTAGACAGG + Intronic
943831027 2:192462425-192462447 ATGATTTGGAATCAAAAGACTGG - Intergenic
945433234 2:209790165-209790187 ATGTTTGATCAAGAAAAGAAAGG + Intronic
945778077 2:214132476-214132498 ATGGTCTAGAATGAAAAGACGGG + Intronic
945954684 2:216075552-216075574 ATGATTTAGCATGAAAGGCAAGG - Intronic
946054752 2:216891017-216891039 ATGTTTGAGCTAGAAAAAACGGG - Intergenic
946619200 2:221542848-221542870 ATTTTTTAGAATGAAAAGAAAGG + Intronic
947073984 2:226320956-226320978 ATGTTTTCTAATGAAAGGACAGG - Intergenic
1170531054 20:17292294-17292316 TTGTTTTAGAAAGAAAAGAAAGG + Intronic
1171501332 20:25595773-25595795 ATGTTTTCTCATGAGTAGACTGG + Intergenic
1172198961 20:33111896-33111918 TTGTTTTAATATGAAGAGACAGG - Intergenic
1172816053 20:37687319-37687341 ATGCTTTAGTATGAAAGGATAGG - Intergenic
1174778247 20:53365233-53365255 ATGTTTTAGCACCAGAAAACAGG - Intronic
1174879695 20:54265658-54265680 TTGTTTTAGCAAGAAATGATGGG - Intergenic
1175145286 20:56891336-56891358 ATGTTTTCTCATGAATAGATGGG - Intergenic
1175578743 20:60082258-60082280 ATGTTATTCCATGCAAAGACTGG + Intergenic
1176545553 21:8196420-8196442 ATTTTTTAGGATGATAAGACCGG - Intergenic
1176564504 21:8379465-8379487 ATTTTTTAGGATGATAAGACCGG - Intergenic
1177817004 21:25988399-25988421 ATCTTTTAAGAGGAAAAGACAGG + Intronic
1178374845 21:32058230-32058252 AGGTTTTAGGATTTAAAGACAGG + Intergenic
1181906298 22:26199755-26199777 CTCTTTCAGCATGACAAGACTGG + Intronic
1183876405 22:40785942-40785964 ATGTTTTAACATGATCACACTGG + Intronic
1203250424 22_KI270733v1_random:112657-112679 ATTTTTTAGGATGATAAGACCGG - Intergenic
950064350 3:10099893-10099915 ATCATTTAGTATGAAAAGTCTGG + Intronic
951502161 3:23400915-23400937 ATGTTTGAGTTTGAAGAGACAGG + Intronic
951547034 3:23836919-23836941 ATGGTCTATCATGAAAAGATGGG + Intronic
952615933 3:35274083-35274105 ATGTGATAGCATTAAAAGATAGG + Intergenic
955629607 3:60958778-60958800 ATGTTTTATCTTGAACAGAGGGG + Intronic
955930487 3:64051540-64051562 GTGTTTTGTCATGATAAGACTGG - Intergenic
956583913 3:70843807-70843829 CTGTTTTAGAAGAAAAAGACAGG - Intergenic
956611434 3:71127559-71127581 GTGTTTTACCATGAAGAAACTGG - Intronic
956938038 3:74126151-74126173 ATTTTTAAGCATGAAAGGTCTGG - Intergenic
957404207 3:79755984-79756006 AAGTTTTGGAATGAAATGACTGG - Intronic
957502185 3:81071225-81071247 ATGTTTCAGCGTGAAAACACTGG - Intergenic
957541202 3:81571387-81571409 ATGTTTTATAATGACAACACAGG + Intronic
957742813 3:84295041-84295063 TTGTTTCAGCTTGAACAGACAGG + Intergenic
957910504 3:86615047-86615069 ATGTTTTAACATGTAAATTCTGG + Intergenic
958059212 3:88457260-88457282 GTGTTTTCCTATGAAAAGACTGG + Intergenic
958531668 3:95340455-95340477 CTGTTTTAACAGGAAAAGAGGGG + Intergenic
958846339 3:99269513-99269535 ATCTTTTAGCCCCAAAAGACTGG - Intergenic
959003726 3:100995183-100995205 CTGTGTTAGCAGGAAATGACAGG + Intergenic
959314275 3:104782499-104782521 ATCTTTTATCATGAAAATAATGG + Intergenic
961256889 3:125562470-125562492 AAGTTTTGGCTTGATAAGACAGG - Intronic
963140939 3:141945670-141945692 ACGTTTTAGTATGAAAATCCTGG + Intergenic
964229247 3:154443867-154443889 ATGCTTTACAATGAAAAGAGTGG + Intergenic
964268310 3:154926128-154926150 ATCTTTTAGAAGGAAAACACTGG - Intergenic
964758717 3:160113430-160113452 ATGTTTTCTCATGATAGGACTGG - Intergenic
965484652 3:169263764-169263786 TTGTTTTAGCATGAAGGAACTGG + Intronic
965648997 3:170913739-170913761 TTGTTTCAGTCTGAAAAGACAGG + Intergenic
966015749 3:175134573-175134595 AATATATAGCATGAAAAGACAGG + Intronic
966295418 3:178415289-178415311 ATGTTTTCTCATGACTAGACTGG - Intergenic
967161776 3:186745572-186745594 ATGTTTTAGCAGAAAAATAAGGG + Intergenic
968045856 3:195623682-195623704 ATGATTTTACATGAAAAGCCAGG + Intergenic
968308797 3:197666405-197666427 ATGATTTTACATGAAAAGCCGGG - Intergenic
969956566 4:10897199-10897221 ATGTTTCAGCCAGAAAACACAGG - Intergenic
970296530 4:14636795-14636817 TTGTTTTGGCATTAACAGACAGG - Intergenic
971295048 4:25380862-25380884 ATATTTTAGCATGAAATGTGTGG + Intronic
971352723 4:25867348-25867370 ATGTTCTAACAGGAAGAGACTGG - Intronic
972295301 4:37732151-37732173 ATGTTTTTGCATGATTAGACTGG - Intergenic
973783790 4:54316366-54316388 ATGTTTTAGAAAGAAAAGAAAGG - Intergenic
974878766 4:67728959-67728981 AGGTTTTGGCTTGAAAAAACTGG + Intergenic
975454583 4:74575225-74575247 ATGTTTTCACCTGAAAAGATGGG - Intergenic
976540109 4:86264720-86264742 ATGGTTGAGAAAGAAAAGACGGG + Intronic
978174674 4:105715940-105715962 ATGTATAAACATAAAAAGACAGG + Intronic
978502879 4:109427761-109427783 ATGTTATAACATGAAGAGGCTGG - Intergenic
979561851 4:122109828-122109850 AGGTTTTAGGCTGAAAAAACAGG + Intergenic
980608890 4:135130966-135130988 ATGTTTTTGTATGATTAGACTGG + Intergenic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982352997 4:154436465-154436487 ATTTTTTAACATGAAAACACAGG - Intronic
983790148 4:171786265-171786287 AGAATTTAGGATGAAAAGACAGG + Intergenic
984190762 4:176602874-176602896 GTGTTTTAACATGAAATGCCTGG + Intergenic
984714455 4:182913688-182913710 ATGTCTGAGAATGAACAGACTGG - Intronic
985243154 4:187952027-187952049 ATGTTTTTACTTGAAAAGGCAGG - Intergenic
985747435 5:1655160-1655182 ATGATTTTACATGAAAAGCCGGG - Intergenic
987568854 5:19629141-19629163 ATTTTTAAGCATAAGAAGACTGG + Intronic
987863446 5:23512505-23512527 ATGTTTTGACATGAAAAGAATGG + Intronic
988795870 5:34653438-34653460 ATGTTTCGTCATGAAATGACAGG + Intergenic
990120412 5:52444238-52444260 ATGTTTTAGTATTTAGAGACAGG + Intergenic
990586192 5:57213349-57213371 ATGTTTTAGAAGGAAGACACCGG - Intronic
992215766 5:74523488-74523510 ATGTTTTAGCAAAGAGAGACTGG + Intergenic
992885398 5:81153972-81153994 GTGTTTTATAATGAAAACACAGG + Intronic
993237958 5:85339626-85339648 AGGTTTTAGAAAGAAAACACAGG + Intergenic
996745991 5:126846360-126846382 GTGTTTTGGCAAGAAAAGAAGGG - Intergenic
998903965 5:146883730-146883752 ATGTTGTAGCATGCACAAACAGG - Intronic
1002476766 5:179470910-179470932 ATGTTTGAGAATGAGAAGAAGGG - Intergenic
1003305292 6:4921694-4921716 AAGGTTTACCATGAAAAGCCAGG - Intronic
1004874030 6:19937254-19937276 ATGTTTTCTCATGATCAGACTGG + Intergenic
1005217540 6:23548857-23548879 CTGATTTCGCATGAAAAGAGTGG - Intergenic
1005894667 6:30167748-30167770 ACTTTATAGCATGAAAAGAGAGG - Intronic
1006998055 6:38281952-38281974 ATTTATTAGCTGGAAAAGACTGG + Intronic
1008002401 6:46374266-46374288 TTTGTTTAGCATGAAAAGCCAGG - Intronic
1008217930 6:48818208-48818230 ATTTTTTAGCATGAATAGCAAGG + Intergenic
1009737296 6:67692276-67692298 ATCTATTAGCATGCAAAGGCAGG + Intergenic
1009751224 6:67881439-67881461 TTTTGTTAGCATAAAAAGACAGG - Intergenic
1010783555 6:79972954-79972976 ATGTTTTCACATGATTAGACTGG - Intergenic
1012511791 6:100011003-100011025 ATTTTTAAGTATGAAAAAACAGG - Intergenic
1012867805 6:104638999-104639021 ATGTTTGAGGATTAAAATACTGG + Intergenic
1014026529 6:116653639-116653661 ATGTTGTAGCATGGAATGAATGG + Intronic
1015471586 6:133612345-133612367 ATTAATTAGCTTGAAAAGACTGG - Intergenic
1016491825 6:144613380-144613402 ATGTCTTATCAAGAAATGACAGG + Intronic
1016555445 6:145331193-145331215 ATGTTTTAGCATGCAGAGGCAGG - Intergenic
1017040436 6:150304215-150304237 ATGTTTCATAATGAAAAGATGGG + Intergenic
1018307892 6:162477529-162477551 ATGGTTTTGAATGAAAGGACTGG - Intronic
1019810264 7:3159854-3159876 ATGTTTTAACAAGAAAAGAAGGG - Intronic
1020397876 7:7737497-7737519 ATGTTGTAGGATTAAAAGCCTGG + Intronic
1020945282 7:14597659-14597681 ATGTATAATCAGGAAAAGACTGG + Intronic
1021073316 7:16270766-16270788 ATATTTTAGCGTGAATATACAGG - Intronic
1021084583 7:16407515-16407537 CTGTTTTAGCATGAAAGTATAGG - Intronic
1021274604 7:18634422-18634444 ATGTTTTGCCATGAAAACAAAGG + Intronic
1021844910 7:24755197-24755219 TTGATTTATCATGACAAGACTGG - Intronic
1022586510 7:31618361-31618383 GTGTGTTAGCAGGAAAGGACAGG - Intronic
1024678007 7:51655196-51655218 ATGTTGTAGCATGAAAGGTTGGG - Intergenic
1024813515 7:53241078-53241100 ATGTTTTCTCATGACTAGACTGG + Intergenic
1024839572 7:53570128-53570150 AAGTGTTAGCATGAAAATAGAGG - Intergenic
1024879459 7:54069183-54069205 ATGGTTTATCATGATTAGACTGG - Intergenic
1026997509 7:74627857-74627879 ATGTTTGTGCTTGAAAAAACCGG - Intergenic
1027758496 7:82247611-82247633 GTGCTTTATCATGAAAACACAGG + Intronic
1028097029 7:86773602-86773624 TTGCTTTAGAATGAAAAGTCTGG - Intronic
1028388263 7:90284952-90284974 ATGTTTTAGGAAGAAGAAACTGG + Intronic
1028701181 7:93782429-93782451 ATGTTTTCCCATGATTAGACTGG - Intronic
1028708473 7:93879055-93879077 ATCTTTTAGCATCAAATAACAGG + Intronic
1029105029 7:98167932-98167954 ATGTTTAAGCAAGGAAAGAACGG + Intronic
1030751036 7:113233139-113233161 AGAATTTGGCATGAAAAGACTGG - Intergenic
1031264341 7:119565184-119565206 ATATTTTGGAATGAGAAGACAGG + Intergenic
1033667770 7:143458989-143459011 ATGTGTTTGCAGGAAAAGGCAGG + Intergenic
1033901538 7:146147431-146147453 CTGCTACAGCATGAAAAGACAGG - Intronic
1034516827 7:151587625-151587647 ATGATTTATCATGATTAGACTGG - Intronic
1036199096 8:6751829-6751851 ATGTTGTAATATGAAAATACTGG - Intronic
1037047328 8:14324033-14324055 ATGTTTTAGCTTGAAATAGCAGG - Intronic
1039011858 8:33102364-33102386 TTGTTTTAGGATGAAATGAGAGG + Intergenic
1039597064 8:38799500-38799522 AAGTTTTAGCAGCAAAAGATAGG + Intronic
1042874791 8:73431469-73431491 ATGTGTTGACCTGAAAAGACAGG - Intronic
1046073640 8:109289273-109289295 ATGTTTTAGCATGAAAAGACTGG - Intronic
1046726259 8:117677777-117677799 ATATTCTAGAAGGAAAAGACAGG + Intergenic
1046738880 8:117807641-117807663 ATGTTTTAGCTTGAACAGACTGG - Intronic
1048372463 8:133791406-133791428 ATGTTGTAGAATGAAATGAGAGG + Intergenic
1048630624 8:136238558-136238580 AATTTTTAGCATGAAATCACTGG - Intergenic
1050036534 9:1442119-1442141 TTGTTTTGTCATGAACAGACTGG + Intergenic
1050556099 9:6790894-6790916 AGGTTTTACTATGAAAACACAGG - Intronic
1050757577 9:9026298-9026320 ATGTTGAGGCATGAAAAGCCTGG + Intronic
1051287874 9:15514348-15514370 ATCCTTTAGGATGAAAATACAGG + Intergenic
1051521112 9:17989833-17989855 TTTTTTTAGCATGCAAAGAAAGG + Intergenic
1051925411 9:22318864-22318886 ATGTTATATGATGTAAAGACTGG - Intergenic
1052040639 9:23735147-23735169 ATTTTTTGGCATTTAAAGACAGG - Intronic
1052847361 9:33349075-33349097 ATGTTTTAGAATGGATAAACTGG - Intronic
1057990401 9:99762834-99762856 ATGGTCTAGCATGAAAAGACGGG - Intergenic
1203466825 Un_GL000220v1:95929-95951 GTTTTTTAGGATGATAAGACCGG - Intergenic
1185510094 X:657589-657611 ATGTTTTATCATAAAAGCACAGG + Intronic
1186338144 X:8614244-8614266 GTGTTTTACCTTGGAAAGACTGG - Intronic
1192192251 X:68998212-68998234 TTGTTTTAGCAGCAAAAGCCAGG - Intergenic
1193158731 X:78203922-78203944 ATGTCTTACCATAAAAAGATAGG - Intergenic
1194188986 X:90811164-90811186 ATGTTTTAAAATGAAAATGCTGG + Intergenic
1197119901 X:122878690-122878712 ATTTTTGAGAATGCAAAGACTGG - Intergenic
1197791417 X:130257619-130257641 GTTTTTTAGCTTGAAAAAACAGG + Intronic
1197891134 X:131271730-131271752 ATGTTTTAGAAGGAAAAAAATGG - Intergenic
1199365534 X:146977290-146977312 AATTTTTATCATGAAAAGATAGG + Intergenic
1202097982 Y:21273544-21273566 ATGCTTTAGCAAAAACAGACTGG - Intergenic