ID: 1046082463

View in Genome Browser
Species Human (GRCh38)
Location 8:109387907-109387929
Sequence ACTATCAGCTTCCAAGTAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046082457_1046082463 14 Left 1046082457 8:109387870-109387892 CCAATCAGTCACCTGCCAGCCTC 0: 1
1: 0
2: 5
3: 16
4: 296
Right 1046082463 8:109387907-109387929 ACTATCAGCTTCCAAGTAATAGG No data
1046082460_1046082463 -1 Left 1046082460 8:109387885-109387907 CCAGCCTCCAATAGCATCAGGTA 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1046082463 8:109387907-109387929 ACTATCAGCTTCCAAGTAATAGG No data
1046082461_1046082463 -5 Left 1046082461 8:109387889-109387911 CCTCCAATAGCATCAGGTACTAT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1046082463 8:109387907-109387929 ACTATCAGCTTCCAAGTAATAGG No data
1046082462_1046082463 -8 Left 1046082462 8:109387892-109387914 CCAATAGCATCAGGTACTATCAG 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1046082463 8:109387907-109387929 ACTATCAGCTTCCAAGTAATAGG No data
1046082458_1046082463 3 Left 1046082458 8:109387881-109387903 CCTGCCAGCCTCCAATAGCATCA 0: 1
1: 0
2: 3
3: 21
4: 200
Right 1046082463 8:109387907-109387929 ACTATCAGCTTCCAAGTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046082463 Original CRISPR ACTATCAGCTTCCAAGTAAT AGG Intronic
No off target data available for this crispr