ID: 1046086890

View in Genome Browser
Species Human (GRCh38)
Location 8:109448332-109448354
Sequence CTCAAATACAACTGTGGACA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046086890_1046086894 15 Left 1046086890 8:109448332-109448354 CCATGTCCACAGTTGTATTTGAG 0: 1
1: 0
2: 0
3: 7
4: 192
Right 1046086894 8:109448370-109448392 CAAAATATTAATCCAAGCCAAGG 0: 1
1: 0
2: 0
3: 18
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046086890 Original CRISPR CTCAAATACAACTGTGGACA TGG (reversed) Exonic
903135328 1:21305834-21305856 CACAAATACCGCTGTGGTCATGG + Intronic
905800685 1:40840272-40840294 CTCAGAGACAGCTGTGGAGAGGG + Exonic
905985622 1:42278512-42278534 CCCAAATACAACTCTGGACCAGG - Exonic
910492980 1:87793692-87793714 AGCATATACAGCTGTGGACAGGG - Intergenic
910700954 1:90073487-90073509 TACATATACAACTGTGAACATGG + Intergenic
916482444 1:165226906-165226928 CTAATATACATCTGTGAACAAGG + Intronic
919044309 1:192431382-192431404 CTCAAATAAGACTTTGGACTTGG + Intergenic
920325076 1:205156662-205156684 CTCAGATAAAACTTTGGACTTGG + Intronic
920626582 1:207607803-207607825 AACAAATACAACTGAAGACATGG - Intronic
922370933 1:224910016-224910038 CTCATATAAAACTTTGGACTTGG - Intronic
924009073 1:239644459-239644481 CTCAAATACATTTGTGATCAAGG - Intronic
924165235 1:241274460-241274482 CTCTAACACAACTATGTACATGG + Intronic
924898288 1:248366837-248366859 CTGAAATACAGCTTTAGACAGGG - Intergenic
1064308785 10:14192685-14192707 CTCAAGTACATCAGTGAACATGG + Intronic
1065515003 10:26516229-26516251 CTCAAATTCATCTTTGGAGAAGG - Intronic
1067813280 10:49448184-49448206 CTCAATAACAAATGTTGACAAGG - Intergenic
1068382524 10:56275275-56275297 CCCAAGTAAAAATGTGGACATGG + Intergenic
1069809093 10:71145217-71145239 CCCAAATGCCACTGTGGATAGGG + Intergenic
1069860264 10:71466677-71466699 CACACACACAAATGTGGACAAGG - Intronic
1069934371 10:71905219-71905241 CTAAAATCCAGGTGTGGACAGGG - Intergenic
1071428101 10:85580035-85580057 CTCGAATACAACAGTGTGCAGGG - Intergenic
1071566335 10:86673194-86673216 CCCAAATGGAACTGTGGACCTGG + Intronic
1072877018 10:99183374-99183396 TCCAAAAACAACTGTGTACAGGG - Intronic
1073997505 10:109332713-109332735 CTCCAGTACCACAGTGGACAAGG - Intergenic
1074170620 10:110931859-110931881 CTAGAATACAACTGTGAAAAAGG + Intronic
1074279153 10:112034708-112034730 CTAAATTGCAAATGTGGACAAGG + Intergenic
1074587330 10:114780822-114780844 CTGAAAGACCACAGTGGACAGGG + Intergenic
1077245473 11:1534994-1535016 CTCAAATTAAACTGTGGTGATGG + Intergenic
1078730563 11:13970411-13970433 CTCAACCACAACTGTAGAGAGGG - Intronic
1078989963 11:16636492-16636514 CTCAAATAAGACTTTGGACTTGG + Intronic
1079006064 11:16791854-16791876 CTCACAGAACACTGTGGACAGGG - Intronic
1079645579 11:22860566-22860588 CTGGAATACAACTGGGGAAAGGG - Intergenic
1087526637 11:99322057-99322079 AACTAATACAACTGGGGACAAGG - Intronic
1092403410 12:8197260-8197282 CTCAAATAAGACTTTGGACTTGG - Intergenic
1092719858 12:11431148-11431170 CTCAAATCCTACTATGGAAATGG + Intronic
1094253400 12:28393326-28393348 CTCTAAAACAACTGTGGATACGG - Intronic
1096204755 12:49711798-49711820 CTCAAATTAAAGTGTTGACAGGG - Intronic
1096748728 12:53745349-53745371 CTCAAAAACCAGAGTGGACAAGG + Intergenic
1099911352 12:88838358-88838380 CTCAGATAAAACTTTGGACTTGG - Intergenic
1102991192 12:117317674-117317696 CTCAATTACATCTGGGAACAAGG - Intronic
1103733148 12:123041951-123041973 CTCAAAGACATCAGTGAACATGG - Intronic
1106085255 13:26535932-26535954 CTCAAACACATCTGTCCACATGG - Intergenic
1106875909 13:34072625-34072647 CACAAATAGAACTTTGCACAAGG - Intergenic
1111905421 13:94250313-94250335 ATCAAATACAGTTGTGGAAAAGG + Intronic
1112769795 13:102782555-102782577 CTCAGATGAAACTGTGGACTTGG + Intergenic
1116533975 14:46007652-46007674 CTCAAATGAAACTATGGACTTGG + Intergenic
1119924958 14:78484739-78484761 CTCTAATGCAGCTGAGGACAGGG - Intronic
1121555476 14:94833354-94833376 ATCAAATCCAAGTGTGAACAGGG + Intergenic
1121730742 14:96185349-96185371 CTCAAACACAACTGTGAAATAGG - Intergenic
1123150503 14:106176885-106176907 CTGAAAGACAAATGTGGACTCGG - Intergenic
1125350861 15:38766242-38766264 TTCAAATAAAACTGTCTACATGG + Intergenic
1127216649 15:56830518-56830540 CAAAAATATAATTGTGGACAGGG + Intronic
1127762346 15:62151590-62151612 CTCCAATGCAGCTGTGGATATGG + Intergenic
1132755642 16:1483421-1483443 CACAAAACCAAGTGTGGACAAGG + Intergenic
1133861145 16:9596821-9596843 CTCAGTAAAAACTGTGGACATGG - Intergenic
1135623982 16:23979756-23979778 TTCAAATACAAGTGTTAACACGG + Intronic
1135956697 16:26962176-26962198 CTTAAGGACAAATGTGGACATGG + Intergenic
1136780105 16:32893328-32893350 CTGAAAGACAAATGTGGACTCGG + Intergenic
1136890502 16:33968199-33968221 CTGAAAGACAAATGTGGACTCGG - Intergenic
1138107097 16:54293424-54293446 CAAAAATACAACTGGGGTCAAGG + Intergenic
1138987947 16:62354122-62354144 CACAAACACTCCTGTGGACATGG - Intergenic
1141525073 16:84605742-84605764 CTAAAATCCAGGTGTGGACAGGG - Intronic
1203082528 16_KI270728v1_random:1155415-1155437 CTGAAAGACAAATGTGGACTCGG + Intergenic
1150321909 17:64221731-64221753 CTGAAATGCCACTGTGAACATGG - Intronic
1152166841 17:78714483-78714505 CACAAACACAACAGTGTACAAGG - Intronic
1154464324 18:14629470-14629492 ATTAAATACATCTGTGCACAGGG + Intergenic
1157077359 18:44480076-44480098 CTCAGATAAAACTTTGGACTTGG + Intergenic
1157646918 18:49283630-49283652 ATCAAATAAAACTCTGAACATGG + Intronic
1157894637 18:51453987-51454009 CCCAGATACAAGTGGGGACATGG + Intergenic
1159649217 18:70957335-70957357 GTCAAAAACAACAGAGGACAAGG - Intergenic
1159652391 18:70993520-70993542 CTCACATACTAATTTGGACATGG + Intergenic
1160215788 18:76929031-76929053 CTGAAACACACCTGTGGAGAAGG + Intronic
1163195322 19:15715508-15715530 ATCAAATAAAACGGTGGAGAAGG - Intergenic
1164127623 19:22332943-22332965 CACAATTACACCTGTGGACTGGG + Intergenic
1164455671 19:28404589-28404611 CTCAAAGTCAACTCTGGAGAAGG - Intergenic
1165602982 19:37073831-37073853 CTCAAAGACAAATGGGGACACGG + Intronic
925467561 2:4121737-4121759 TTCAAATACAACTTTTGATAAGG - Intergenic
927707430 2:25305142-25305164 TACAAATACAACTGTGTACGAGG + Intronic
929010720 2:37441395-37441417 CTCAATAAAAACTCTGGACATGG + Intergenic
929429018 2:41871154-41871176 CTCAAATCCAAATGAGGACTGGG - Intergenic
931080141 2:58759944-58759966 TAGAGATACAACTGTGGACAAGG + Intergenic
933112465 2:78421005-78421027 TTAAAATACAACTGTGGAACAGG + Intergenic
933266679 2:80188526-80188548 CTAAAATAAAGATGTGGACAGGG + Intronic
934503823 2:94877207-94877229 CTCACATACTCCTGTGGACAGGG + Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
937583333 2:123515715-123515737 CTCAAATAAAAGTGTTGCCAGGG - Intergenic
939363280 2:141201472-141201494 CTCAAATAAAACCGTGGACTAGG - Intronic
939553796 2:143649291-143649313 CTCAAATTCTCCTTTGGACAAGG + Intronic
939771379 2:146323874-146323896 CTCAAATACATCTGGGAACAAGG - Intergenic
941243558 2:163070134-163070156 CTCAATTACAACTGAGGAGGTGG - Intergenic
942430454 2:175905894-175905916 CTCAATTACAAGTGAGAACATGG + Intergenic
943395640 2:187329355-187329377 CTCAAATGAGACTTTGGACATGG + Intergenic
945432822 2:209784732-209784754 TTTAAATACAACAGTGAACAAGG - Intronic
945816734 2:214613904-214613926 CTTAAATACATCTGTAGAAAAGG - Intergenic
946669504 2:222087579-222087601 GTCAAATACAAATGGGAACATGG + Intergenic
946903596 2:224395282-224395304 AAAAAATACAACTTTGGACACGG + Intronic
948934353 2:241152978-241153000 CTCAAATCAGACTGTGGGCAGGG - Intronic
1170853424 20:20024776-20024798 CTCAAATACAACCCTTAACATGG - Intronic
1172567174 20:35939722-35939744 CTCACTGACAACTGAGGACAGGG - Intronic
1172582499 20:36059381-36059403 CACAAATACTGCTGAGGACAAGG - Intergenic
1172702162 20:36860425-36860447 CTGGGATACAGCTGTGGACAAGG - Intronic
1174703968 20:52637020-52637042 CTCAGATAAAATTGTGGTCAGGG + Intergenic
1176810214 21:13528919-13528941 ATTAAATACATCTGTGCACAGGG - Intergenic
1183670338 22:39269102-39269124 GTCTAAGACCACTGTGGACATGG + Intergenic
1184205685 22:43001038-43001060 CTCAAATAAAACTTAGGCCAAGG + Intronic
1184527677 22:45035181-45035203 CTCAAAGACATCTTTGGCCAAGG + Intergenic
949307842 3:2662920-2662942 CTAAAATACAAATGTGAAGATGG - Intronic
949444879 3:4123516-4123538 CTCAAATATAACTGCTAACAAGG + Intronic
950178115 3:10890368-10890390 TCCAAAGACAACTGTGGCCATGG - Intronic
950297852 3:11847376-11847398 TTCAAATACAAGGGTGGATATGG + Intergenic
951804492 3:26629647-26629669 CTTAAATATAATTGTGGAAAGGG - Intronic
952221292 3:31326739-31326761 CTCAGATGAAACTTTGGACATGG - Intergenic
952592405 3:34972807-34972829 TTAAAATACAAATGTGGAAAGGG + Intergenic
957210940 3:77257639-77257661 CCCAAGTACAACTGTGCAAAGGG - Intronic
963405536 3:144858747-144858769 CTCAAATACATGAGTGGAGATGG + Intergenic
964064649 3:152563208-152563230 CCCAATTACAACTGTGGAGGTGG - Intergenic
964712102 3:159682087-159682109 CCCAAATACATTTGAGGACAGGG - Intronic
966635341 3:182127113-182127135 TTAAAATACAACTCTGGATATGG + Intergenic
968540304 4:1164940-1164962 CTCAGAGACACCCGTGGACATGG - Intergenic
969762658 4:9200600-9200622 CTCAAATAAGACTTTGGACTTGG + Intergenic
971442890 4:26709280-26709302 TTCAAAAACAACTGTGTATAAGG - Intronic
972285738 4:37646192-37646214 CTCAAATATCACTGAGGGCATGG + Intronic
972800091 4:42465625-42465647 CTCTTATACAAATGTGGACCAGG + Intronic
974252961 4:59412594-59412616 CTCAGCTACAACTCTGGGCAGGG - Intergenic
974872589 4:67661133-67661155 CTCAGATAAGACTTTGGACATGG + Intronic
975595686 4:76046797-76046819 CTCAATTACAACTGAGGATGTGG + Intronic
976442366 4:85089767-85089789 CTCAGATAAGACTTTGGACATGG + Intergenic
976611948 4:87039632-87039654 CTAAAATACAAATGTGGAGGAGG + Intronic
976636080 4:87287443-87287465 CTCAGATAAAACTTTGGACTTGG + Intergenic
977691108 4:99912107-99912129 CTCAAAACCAACTGTTGAAAAGG + Intronic
978449377 4:108814321-108814343 TTACAATACAACTGTGGAAAGGG + Intronic
979368528 4:119854886-119854908 CTCAAAGACCAGTGTGGAAAAGG + Intergenic
980295167 4:130904784-130904806 CTCAAATACAGCTGAGGATTTGG - Intergenic
982797429 4:159663200-159663222 CTCAGATAAAATTTTGGACATGG - Intergenic
982944188 4:161597809-161597831 CTCAAATTCTAGTGTGGAGAAGG + Intronic
985254209 4:188053793-188053815 CTCAGGTACATCTGTGGAAAAGG - Intergenic
987697728 5:21354405-21354427 CTCAGATGAAACTTTGGACATGG - Intergenic
988754509 5:34232289-34232311 CTCAGATGAAACTTTGGACATGG + Intergenic
989356942 5:40554094-40554116 CGCACATACATTTGTGGACAAGG - Intergenic
990372685 5:55136629-55136651 CTCAAAAATAAATGTGAACAAGG - Intronic
990503945 5:56426274-56426296 CAAAACTACATCTGTGGACATGG - Intergenic
990820857 5:59838728-59838750 CTCAAAGGCAACTGTCTACAGGG + Intronic
991180184 5:63741843-63741865 CTAAAATACAACTGTGTTTAAGG + Intergenic
991742717 5:69697983-69698005 CTCAGATGAAACTTTGGACATGG + Intergenic
991754977 5:69857221-69857243 CTCAGATGAAACTTTGGACATGG - Intergenic
991794290 5:70277721-70277743 CTCAGATGAAACTTTGGACATGG + Intergenic
991822106 5:70573296-70573318 CTCAGATGAAACTTTGGACATGG + Intergenic
991834304 5:70732369-70732391 CTCAGATGAAACTTTGGACATGG - Intergenic
991886669 5:71277263-71277285 CTCAGATGAAACTTTGGACATGG + Intergenic
995420727 5:111963541-111963563 CTGAAATACATCTCTGGGCAGGG - Intronic
1001835687 5:174829899-174829921 CTCCAATAAATCTCTGGACATGG + Intergenic
1003627771 6:7758858-7758880 CACAAATGCATCCGTGGACAAGG - Intronic
1005910495 6:30305236-30305258 CTCAAATGCTAGTGTGCACAAGG + Intergenic
1009954064 6:70430541-70430563 CTCAAAAACAACTGTGGCTGTGG - Intronic
1010751371 6:79619522-79619544 CTCAAATACCAATGAGGACCAGG - Intergenic
1013188871 6:107785162-107785184 CCCAAATACAACTCTGGACCGGG - Intronic
1013782527 6:113744867-113744889 CGCAAATGTAACTGTGAACAGGG - Intergenic
1014783777 6:125594632-125594654 CTCAGAGACACCTGAGGACAGGG + Intergenic
1015366760 6:132403926-132403948 CTCAATTACATCTGGGGCCAAGG - Intergenic
1015690954 6:135922190-135922212 CTCACATACAACTCTGGGTAAGG + Intronic
1019087525 6:169494141-169494163 CTCAAACACCATTGTGGATACGG + Intronic
1020822317 7:12985476-12985498 GGCACATACAGCTGTGGACATGG - Intergenic
1020971165 7:14941321-14941343 ATCAAATACTTCTGTGGATAAGG - Intronic
1023681436 7:42691495-42691517 TTCAAATACACCTGGGGAAATGG + Intergenic
1024095115 7:45976751-45976773 CTCAAATACTACCGTGGTCTTGG + Intergenic
1028697150 7:93727806-93727828 CTTAGATACACCTGTGGAAAAGG + Intronic
1028783715 7:94768046-94768068 AACAAATAAAACTGTGAACAAGG - Intergenic
1029236972 7:99128607-99128629 CTAAAATTTAAATGTGGACAGGG - Intronic
1030979273 7:116167070-116167092 CTCAAATAAAAGTGTCGGCAGGG - Intergenic
1032377651 7:131438712-131438734 ATCAAAAAAAACTTTGGACATGG - Intronic
1033129700 7:138735293-138735315 CTCAAGTACAGGTGGGGACAGGG - Intronic
1033258942 7:139825622-139825644 CTCACATCAACCTGTGGACATGG - Intronic
1034190303 7:149208501-149208523 CTTAAAAACAACGGAGGACACGG - Intronic
1034222082 7:149454550-149454572 CTCAAATGTTACTGTGCACATGG - Intronic
1036272752 8:7322335-7322357 CTCAAATAAGACTTTGGACTTGG + Intergenic
1036348596 8:7988013-7988035 CTCAAATAAGACTTTGGACTTGG - Intergenic
1036843868 8:12148481-12148503 CTCAAATAAGACTTTGGACTTGG - Intergenic
1036865237 8:12390802-12390824 CTCAAATAAGACTTTGGACTTGG - Intergenic
1040822552 8:51580098-51580120 TTTAAATAAAACTGTGGAAATGG + Intronic
1041136742 8:54767105-54767127 CTGTAACACAACTGTGTACAAGG + Intergenic
1043266187 8:78270320-78270342 CTCAGATAAAACTTTGGACTTGG - Intergenic
1046086890 8:109448332-109448354 CTCAAATACAACTGTGGACATGG - Exonic
1046612920 8:116445381-116445403 CTCAGATACAAATGTGAAGATGG + Intergenic
1049172069 8:141167614-141167636 CTTAAAGACAACTCAGGACAGGG - Intronic
1056142216 9:83693706-83693728 CTCAAAAACAATTGAGAACAGGG - Intronic
1061168562 9:128938851-128938873 CTCAAATACCTCTGGTGACAGGG + Intronic
1185543883 X:926307-926329 GTCAAAGCCAAATGTGGACATGG + Intergenic
1186650896 X:11559014-11559036 CTGAAAAATAGCTGTGGACAGGG - Intronic
1193848963 X:86511837-86511859 CTCAAATCTGACTGTGTACAAGG - Intronic
1194125717 X:90013365-90013387 CTCAGATGCAACTTTGGACTTGG + Intergenic
1194435164 X:93860589-93860611 CTCAAATGAAACTTTGGACTTGG + Intergenic
1194600852 X:95919706-95919728 CTCAAGTACCACCGGGGACAAGG - Intergenic
1194843712 X:98776692-98776714 CTCAAATGAAACTTTGGACTTGG + Intergenic
1196604256 X:117638009-117638031 CTCAAGCACAGCTGTGGAGATGG - Intergenic
1197569597 X:128132367-128132389 CTCAAATGAAACTTTGGACTTGG + Intergenic
1198096138 X:133381591-133381613 CTGAAGTTTAACTGTGGACAGGG - Intronic
1199582548 X:149374766-149374788 TTTAAGTACAATTGTGGACACGG - Intergenic
1201496288 Y:14594002-14594024 CCCAATTACAACTGAGGAGATGG + Intronic
1201648777 Y:16263508-16263530 CCCAAATACAACTGAGGAGGTGG + Intergenic
1201654032 Y:16321792-16321814 CCCAAATACAACTGAGGAGGTGG - Intergenic