ID: 1046092906

View in Genome Browser
Species Human (GRCh38)
Location 8:109524497-109524519
Sequence TGCTCACCTCCTCATGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046092903_1046092906 -9 Left 1046092903 8:109524483-109524505 CCTGAAAAGAAGTTTGCTCACCT 0: 1
1: 0
2: 1
3: 21
4: 180
Right 1046092906 8:109524497-109524519 TGCTCACCTCCTCATGAGGGTGG No data
1046092902_1046092906 -5 Left 1046092902 8:109524479-109524501 CCTACCTGAAAAGAAGTTTGCTC 0: 1
1: 0
2: 1
3: 15
4: 163
Right 1046092906 8:109524497-109524519 TGCTCACCTCCTCATGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046092906 Original CRISPR TGCTCACCTCCTCATGAGGG TGG Intronic
No off target data available for this crispr