ID: 1046094406

View in Genome Browser
Species Human (GRCh38)
Location 8:109540056-109540078
Sequence GTGGAAGGGCGAAAGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1344
Summary {0: 1, 1: 0, 2: 9, 3: 112, 4: 1222}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046094406_1046094423 30 Left 1046094406 8:109540056-109540078 CCACCTTCCTTTCGCCCTTCCAC 0: 1
1: 0
2: 9
3: 112
4: 1222
Right 1046094423 8:109540109-109540131 TGGGTACTGTTTCCGGGTCAGGG 0: 1
1: 0
2: 1
3: 5
4: 100
1046094406_1046094420 23 Left 1046094406 8:109540056-109540078 CCACCTTCCTTTCGCCCTTCCAC 0: 1
1: 0
2: 9
3: 112
4: 1222
Right 1046094420 8:109540102-109540124 GCTGCTCTGGGTACTGTTTCCGG 0: 1
1: 0
2: 1
3: 20
4: 200
1046094406_1046094416 10 Left 1046094406 8:109540056-109540078 CCACCTTCCTTTCGCCCTTCCAC 0: 1
1: 0
2: 9
3: 112
4: 1222
Right 1046094416 8:109540089-109540111 TCGACGCCCGACAGCTGCTCTGG 0: 1
1: 0
2: 0
3: 1
4: 30
1046094406_1046094421 24 Left 1046094406 8:109540056-109540078 CCACCTTCCTTTCGCCCTTCCAC 0: 1
1: 0
2: 9
3: 112
4: 1222
Right 1046094421 8:109540103-109540125 CTGCTCTGGGTACTGTTTCCGGG 0: 1
1: 0
2: 1
3: 21
4: 224
1046094406_1046094417 11 Left 1046094406 8:109540056-109540078 CCACCTTCCTTTCGCCCTTCCAC 0: 1
1: 0
2: 9
3: 112
4: 1222
Right 1046094417 8:109540090-109540112 CGACGCCCGACAGCTGCTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 44
1046094406_1046094422 29 Left 1046094406 8:109540056-109540078 CCACCTTCCTTTCGCCCTTCCAC 0: 1
1: 0
2: 9
3: 112
4: 1222
Right 1046094422 8:109540108-109540130 CTGGGTACTGTTTCCGGGTCAGG 0: 1
1: 0
2: 0
3: 15
4: 552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046094406 Original CRISPR GTGGAAGGGCGAAAGGAAGG TGG (reversed) Intronic
900384088 1:2401414-2401436 GGGGATGGGAGAGAGGAAGGAGG - Intronic
900391665 1:2436433-2436455 GAGGAAGGGAGGAAGGGAGGAGG - Intronic
900681806 1:3920541-3920563 GAGGGAGGGGGGAAGGAAGGAGG - Intergenic
900847039 1:5112366-5112388 GAGGAAGAGGGAGAGGAAGGGGG + Intergenic
900993124 1:6106960-6106982 GTGGAGGGGTGGAAGGATGGAGG + Intronic
900993166 1:6107106-6107128 GTGGAAGGACGGAGGGATGGAGG + Intronic
900993365 1:6107920-6107942 ATGGAAGGATGGAAGGAAGGTGG + Intronic
901006581 1:6174600-6174622 GTGGATGGACGAATGGATGGTGG + Intronic
901315977 1:8308620-8308642 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
901528320 1:9837937-9837959 GAGGAAGGGAGGAAGGAAGGAGG + Intergenic
901685641 1:10941997-10942019 TTGGAAGGGCTGAAGGGAGGAGG + Intergenic
901696380 1:11011294-11011316 GAGGTAGGGAGGAAGGAAGGTGG + Intergenic
901905980 1:12411474-12411496 ATGGAAGGAAGGAAGGAAGGAGG + Intronic
902167945 1:14587613-14587635 GAGGAAGAGAGAAAGGGAGGAGG + Intergenic
902690492 1:18107733-18107755 GAGGGAGGGCGAGAGGAGGGGGG + Exonic
902769366 1:18636769-18636791 GAGGGAGGGAGAGAGGAAGGAGG + Intronic
902905329 1:19552470-19552492 GTGAAAGGGAGAATGGTAGGAGG - Intergenic
903033348 1:20478722-20478744 GTGGAACAGAGAAAGGATGGTGG + Intergenic
903147069 1:21381200-21381222 GTGGAAGGGGGAATAGAGGGTGG - Intergenic
903149665 1:21397868-21397890 GAGGAGGGGTGAAAAGAAGGTGG + Intergenic
903240317 1:21978383-21978405 CTGGAAGGGCGAGAGGAAGGTGG - Exonic
903244065 1:22003017-22003039 CTGGAAGAGTGAGAGGAAGGTGG - Exonic
903333572 1:22610043-22610065 GAGGGAGGGAGGAAGGAAGGAGG - Intergenic
903510252 1:23869251-23869273 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
903630951 1:24770266-24770288 GAGGAAGGGAGAAAGGGAGAGGG - Intronic
903690041 1:25166951-25166973 GAGGGAGGGAGGAAGGAAGGAGG + Intergenic
904035673 1:27557274-27557296 CTGGAAGGGCCAAGGGCAGGAGG - Intronic
904087131 1:27916952-27916974 GAGGGAGGGAGGAAGGAAGGAGG - Intergenic
904087147 1:27916999-27917021 GAGGGAGGGAGGAAGGAAGGAGG - Intergenic
904112825 1:28140000-28140022 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
904261638 1:29291050-29291072 GTGGGAGGGAGAAAAGGAGGTGG - Intronic
904277481 1:29393903-29393925 GAGGAAGGGAGGAAGGAAGTGGG - Intergenic
904310612 1:29627113-29627135 GTGGAGGGTGGAAAGGGAGGTGG - Intergenic
904586083 1:31581388-31581410 GTGGAGGGGCGAGAGGTAGGTGG + Intronic
904653652 1:32025731-32025753 GAGAAAGGGAGGAAGGAAGGAGG - Intronic
904750953 1:32741481-32741503 GGGGAAGGGCGCAGGAAAGGAGG - Intergenic
904752405 1:32749180-32749202 ATGGAAGGATGAAAGGAAGCTGG + Intronic
904904215 1:33882801-33882823 ATGGAAGGAAGAAAGGAAAGGGG - Intronic
904998526 1:34650229-34650251 GAGGGAGGGAGGAAGGAAGGAGG + Intergenic
905223647 1:36465916-36465938 AAGGAAGGGAGGAAGGAAGGGGG + Intergenic
905317077 1:37089527-37089549 GGGGAAGAGGGAATGGAAGGAGG + Intergenic
905323051 1:37131293-37131315 ATGGAGGGGGGAAAGGAAGTGGG - Intergenic
905396506 1:37669894-37669916 GAGGAAGGAAGAAAGGGAGGAGG - Intergenic
905977299 1:42185809-42185831 GTGGAAGGGGGAAGGGGAGAAGG - Intronic
906376333 1:45299653-45299675 GTGGAAGGGGTTGAGGAAGGGGG - Intronic
906378575 1:45316878-45316900 GATGAAGGGGGAAAGGAGGGTGG - Intergenic
906477315 1:46178402-46178424 GAGTAAGGGGGAAAGGAAGAAGG - Intronic
906680634 1:47723473-47723495 GGGGAAGAGCGGCAGGAAGGAGG + Intergenic
906794759 1:48688094-48688116 GTGGAAGGAAGCAAGGAAGAAGG + Intronic
907381193 1:54091716-54091738 CTGGAAGGGAGAAAGTAAAGGGG - Intronic
907437447 1:54458821-54458843 AAGGAAGGGAGGAAGGAAGGAGG + Intergenic
907437483 1:54458932-54458954 GAGGAAGGCAGGAAGGAAGGAGG + Intergenic
907560792 1:55385681-55385703 GAGGAAGGAAGGAAGGAAGGAGG - Intergenic
907801674 1:57772201-57772223 GTGGAGGGAGGAAAGGCAGGAGG - Intronic
907802389 1:57782994-57783016 GAGGAAGGAAGGAAGGAAGGAGG - Intronic
907831183 1:58065733-58065755 GTGGAGGGGGAAAAGGAAGCAGG + Intronic
907915136 1:58861342-58861364 GAGGAAGGGAGGAGGGAAGGGGG + Intergenic
908422184 1:63969785-63969807 GTGAAAGGGAGAAAGACAGGTGG - Intronic
908967936 1:69787984-69788006 AAGGAAGGGAGGAAGGAAGGAGG - Intronic
909483081 1:76146505-76146527 GTGTGAGGGAGAAAAGAAGGAGG - Intronic
909767282 1:79372146-79372168 GAGGGAGGGAGGAAGGAAGGAGG - Intergenic
910117567 1:83749195-83749217 GTGGAAGGTGGAAAGGCAAGAGG + Intergenic
910170739 1:84374210-84374232 GGGAAAGGGTCAAAGGAAGGAGG - Intronic
910682466 1:89881654-89881676 GTGGAAGGGAGAACCTAAGGGGG + Intronic
910846795 1:91611918-91611940 GTGGATGGGGGCAAGGAGGGAGG + Intergenic
910880222 1:91916376-91916398 GTGGAAGGGAGACAGGAAAAGGG + Intergenic
911053931 1:93695031-93695053 GTGGGAGGGCGAGGGGAATGTGG - Intronic
911708171 1:101039682-101039704 GTGGAAGGCAAAAAGGAAGCAGG + Intergenic
912271181 1:108210432-108210454 GAGGAAGGAAGGAAGGAAGGAGG - Intergenic
912391190 1:109304298-109304320 AAGGAAGGACGGAAGGAAGGAGG + Intronic
913027203 1:114855227-114855249 GCGGTAGGGCGAAAGGGAGAAGG + Intronic
913063849 1:115231924-115231946 GGGGAAGGGAGAGAGAAAGGAGG - Intergenic
913105249 1:115608474-115608496 GAGGAAAGGTGAAAAGAAGGAGG + Intergenic
913125981 1:115790835-115790857 GTGAAAGAGCAAAAGGCAGGGGG + Intergenic
913532559 1:119743118-119743140 GAAGAGGGGCTAAAGGAAGGTGG - Intronic
914716942 1:150261375-150261397 GGGGAAGGGTCAAAGGGAGGGGG + Intronic
914989264 1:152484462-152484484 GTGTAAGGGAGAAAGGAAACAGG - Intergenic
915132835 1:153707748-153707770 GAGGAAGGGAGGAAGGAAAGGGG + Intergenic
915311229 1:155006786-155006808 GAGGAAAGGAGGAAGGAAGGAGG - Intronic
915650820 1:157309213-157309235 AAGGAAGGAAGAAAGGAAGGTGG - Intergenic
916424006 1:164663338-164663360 ATGGAAGGAAAAAAGGAAGGAGG - Intronic
916644033 1:166764363-166764385 TTGGTAGGGCGAGAGGAAGGAGG + Intergenic
917516208 1:175710656-175710678 GTGGAAGTGGGAAGGAAAGGGGG - Intronic
917621105 1:176796874-176796896 AGGGAAGGAAGAAAGGAAGGAGG - Intronic
917667118 1:177235852-177235874 GTGGATGGGAAAAAGGAAGGAGG + Intronic
918079236 1:181192935-181192957 GTGGAAGGACTAAAGACAGGAGG - Intergenic
918085744 1:181243777-181243799 GAGGAATGGGGAAAGGAAGGAGG - Intergenic
918532228 1:185536682-185536704 AAGGAAGGGAGAAAGGAAGGGGG - Intergenic
918640075 1:186829125-186829147 TTGGAAGGAAGAAAGGACGGAGG + Intronic
918895378 1:190336871-190336893 GAGGAAGGAAGGAAGGAAGGAGG - Intronic
918972627 1:191439539-191439561 AAGGAAGGAGGAAAGGAAGGAGG - Intergenic
919505916 1:198397488-198397510 ATGGAAGGAGGAAAGGAAGGAGG - Intergenic
919517898 1:198550215-198550237 GGGGAAGGGTGAAAGGAAAGAGG - Intergenic
919518293 1:198554932-198554954 AGGGAAGGAGGAAAGGAAGGAGG - Intergenic
919635691 1:200000936-200000958 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
919812089 1:201415106-201415128 ATGGCAAGGAGAAAGGAAGGAGG - Intronic
919888797 1:201955165-201955187 AGGGAAGGGGGAAGGGAAGGCGG + Intergenic
920023705 1:202976173-202976195 GAGGAAGGAAGGAAGGAAGGAGG - Intergenic
920037222 1:203074093-203074115 GAGGTAGGGAGAAGGGAAGGAGG + Intronic
920851697 1:209632547-209632569 GTGGGAAGGGGAGAGGAAGGGGG - Intronic
921047992 1:211490948-211490970 CTGCAAGGGCGAGAGGAATGTGG + Intronic
921442392 1:215203003-215203025 GAGGAAGAGGGAAGGGAAGGAGG - Intronic
921465223 1:215478693-215478715 GTGGAAGGGGAAGAGGAAGAAGG + Intergenic
921816746 1:219572549-219572571 AAGGAAGGAAGAAAGGAAGGAGG + Intergenic
922176135 1:223199482-223199504 GAGGAAGAGGAAAAGGAAGGAGG - Intergenic
922723233 1:227909661-227909683 GAGGAAGGAGGGAAGGAAGGAGG + Intergenic
922844564 1:228673660-228673682 GCGGAAGGTGAAAAGGAAGGAGG - Intergenic
922902321 1:229146782-229146804 TTGGAAGTGGGAAGGGAAGGAGG - Intergenic
923233375 1:232009671-232009693 GGGGAAGGGAGAGAGGAAAGAGG - Intronic
923268473 1:232334603-232334625 GGGGAGGGGCAAAAGGGAGGAGG - Intergenic
923460768 1:234207406-234207428 GAGGGAGGGAGAAAGGAAGGAGG - Intronic
923580891 1:235211327-235211349 GTGGAAGGAAGGAGGGAAGGAGG + Intronic
923774422 1:236965891-236965913 TGGGAAGGAAGAAAGGAAGGGGG - Intergenic
924202578 1:241675101-241675123 GAGGGAGGGAGGAAGGAAGGAGG - Intronic
924442786 1:244100680-244100702 GTGGAAAAGAGAAAGGAAAGGGG - Intergenic
924585919 1:245361194-245361216 CTGGGAGGGCCAAAGGCAGGTGG - Intronic
1062812590 10:477605-477627 GTGGATGGGTGGGAGGAAGGTGG + Intronic
1062815123 10:493709-493731 GTGGACAGGAGAAAGGATGGAGG + Intronic
1062960364 10:1568585-1568607 GAGGAAGGAGGAAAGGAGGGAGG + Intronic
1063156284 10:3382163-3382185 AAGGAAGGAAGAAAGGAAGGAGG + Intergenic
1063235992 10:4117283-4117305 ATGGAAGGAAGGAAGGAAGGAGG + Intergenic
1063349144 10:5338253-5338275 AAGGAAGGAAGAAAGGAAGGAGG - Intergenic
1063484281 10:6404731-6404753 AGGGAAGGGAGGAAGGAAGGAGG - Intergenic
1063484306 10:6404913-6404935 AGGGAAGGGAGGAAGGAAGGAGG - Intergenic
1063534177 10:6866900-6866922 GAGGAAAGGAGGAAGGAAGGAGG - Intergenic
1063579992 10:7297525-7297547 GGGAAAGGGCGAATGGGAGGGGG + Intronic
1064526344 10:16260482-16260504 AAGGAAGGGGGAAGGGAAGGAGG + Intergenic
1064672549 10:17731397-17731419 GGGGACAGGGGAAAGGAAGGTGG + Intergenic
1064754186 10:18559823-18559845 ATGGAATGGAGAAAGGAATGGGG + Intronic
1064769750 10:18711358-18711380 GGGGGAGGGGGAGAGGAAGGGGG - Intergenic
1065115661 10:22480278-22480300 GTGGAAGGTAAAAAGGAAGCAGG - Intergenic
1065177634 10:23095265-23095287 AGGGAAGGGAGAGAGGAAGGGGG + Intergenic
1065177639 10:23095277-23095299 GAGGAAGGGGGAGAGGAAGGGGG + Intergenic
1065390005 10:25174067-25174089 GTGTAAGGGAGAGAGCAAGGGGG - Intergenic
1065732004 10:28718068-28718090 GAGGGAGGGAGGAAGGAAGGAGG - Intergenic
1065890764 10:30119237-30119259 GTGGCAGGGGAAAAGGCAGGAGG + Intergenic
1066371539 10:34822024-34822046 GAGGGAGGGAGGAAGGAAGGAGG + Intergenic
1066423170 10:35280403-35280425 AAGGAAGGAAGAAAGGAAGGAGG + Intronic
1066497880 10:35959882-35959904 GAGGAAGGGAAAAAGGAAAGAGG - Intergenic
1066671471 10:37844952-37844974 GGGGAAGGGAAGAAGGAAGGGGG - Intronic
1067096284 10:43302832-43302854 GTGACAGGGCAAAAGAAAGGTGG + Intergenic
1067878362 10:50023955-50023977 ATGGAGGGGGGAAAAGAAGGTGG - Intergenic
1067893360 10:50153973-50153995 ATGGAGGGGGGAAAAGAAGGTGG + Intergenic
1068521896 10:58085969-58085991 GTGGAAGGTCAAAAGGAAGGAGG - Intergenic
1068922149 10:62496013-62496035 GTGGGAGGGAGAAAGAAAGAGGG - Intronic
1068972885 10:62977734-62977756 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
1069289716 10:66763067-66763089 GTGGTAGGGAGCAAGGAAGTAGG + Intronic
1069313347 10:67066698-67066720 GTAGAAGGCAGAAAGGAAGAGGG - Intronic
1070694014 10:78548471-78548493 GAGGAGGGAAGAAAGGAAGGAGG + Intergenic
1070741459 10:78906023-78906045 GTGGAATGGCGAGCGGCAGGAGG + Intergenic
1070776803 10:79114545-79114567 GTGGGAGGGAGAAGGGAGGGAGG + Intronic
1070781583 10:79140596-79140618 GTGGAAGGACTAAAAGAAAGAGG - Intronic
1071073968 10:81729570-81729592 ATGGAAGGAAGGAAGGAAGGGGG + Intergenic
1071444767 10:85735790-85735812 GAGGAAGGGAGGAAGGAAGGAGG + Intronic
1071499586 10:86193833-86193855 GTGGAAGGGAGGGAGGGAGGTGG - Intronic
1071973289 10:90930125-90930147 ATGGAAGGGAGGAAGGTAGGAGG - Intergenic
1072002095 10:91206442-91206464 GTGGGAGGGAGAAAGGAATTAGG + Intronic
1072666091 10:97393624-97393646 GTGGAGGGGAGAAGGGAATGTGG - Intronic
1073072447 10:100803281-100803303 GTGGAAGGGCAGAAAGAAGGAGG - Intronic
1073310274 10:102535165-102535187 GAGGAAGGGGAAGAGGAAGGGGG + Intronic
1073331683 10:102674153-102674175 GAGGGAGGGAGGAAGGAAGGGGG + Exonic
1073439544 10:103544385-103544407 GTGGAAGGGGGAATGGGAGAAGG + Intronic
1073446329 10:103582597-103582619 GTGAAAGGGTGAAAGAAAAGAGG + Intronic
1073459502 10:103658541-103658563 GTGGAGGGGAGAAAGGAAGAGGG - Intronic
1073592129 10:104767628-104767650 GTGGAAGTGGGAGGGGAAGGGGG - Intronic
1074326445 10:112455468-112455490 GAGGGAGGGAGGAAGGAAGGAGG - Intronic
1074609140 10:115004461-115004483 ATGGAAGGGAGGAAGGAGGGAGG - Intergenic
1074651468 10:115528026-115528048 AAGGAAGGAAGAAAGGAAGGAGG - Intronic
1074969650 10:118525627-118525649 GAGGAAGAGAGAGAGGAAGGAGG - Intergenic
1075122656 10:119675779-119675801 GGGGAAGGGGGGAAGGGAGGGGG - Intronic
1075122711 10:119675901-119675923 GAGGAAGGAAGGAAGGAAGGGGG - Intronic
1075129423 10:119725844-119725866 GCGGAAGGACGAGAGGGAGGAGG + Intergenic
1075566717 10:123510397-123510419 TTGGAAGGAGGAGAGGAAGGCGG - Intergenic
1075584209 10:123645406-123645428 GGGGAAGAGAGAAAAGAAGGAGG + Intergenic
1076001491 10:126916673-126916695 AAGGAAGGAGGAAAGGAAGGAGG - Intronic
1076778110 10:132709312-132709334 GGGGGAGGGGGAAAAGAAGGAGG + Intronic
1077017779 11:404530-404552 GTAGAAGGGCTATCGGAAGGAGG + Exonic
1077279952 11:1739318-1739340 GTGGATAAGAGAAAGGAAGGAGG + Intronic
1077522697 11:3045697-3045719 GTGGAAGGGCGAGCAGGAGGAGG + Intronic
1077783200 11:5354617-5354639 GTGGAGGGGCGGGAGGAAGTGGG - Intronic
1078254325 11:9644572-9644594 GTGGAAGGAAGAAAAGAAAGTGG - Intergenic
1078254491 11:9646309-9646331 GTGGAAGGAAGAAAGGAAAGAGG + Intergenic
1078615095 11:12857437-12857459 GTGTAAGGCAGAAAGGAAGACGG + Intronic
1078766261 11:14301424-14301446 GAGGAAGGGAGAAAAGAGGGAGG - Intronic
1079459585 11:20668648-20668670 GTGGGAGAGGGAAAAGAAGGTGG + Intergenic
1079640069 11:22794299-22794321 GTGGAAAGGGGTAAGAAAGGAGG - Intronic
1079683503 11:23326969-23326991 GTGGAGGGGGGAGAGGGAGGGGG + Intergenic
1080416412 11:32073413-32073435 GTGGCAGAATGAAAGGAAGGGGG - Intronic
1081395911 11:42586061-42586083 GTGGAAGGCAAAGAGGAAGGAGG + Intergenic
1081684750 11:45034451-45034473 AGGGAAGGGAGAAAGCAAGGGGG + Intergenic
1081747210 11:45481708-45481730 GAGGAGGGGAGGAAGGAAGGAGG - Intergenic
1081896720 11:46593499-46593521 GGGAAAAGGAGAAAGGAAGGAGG + Intronic
1082132404 11:48506462-48506484 AGGGAAGGGGGAAGGGAAGGGGG - Intergenic
1082132410 11:48506474-48506496 AGGGAAGGGGGAAGGGAAGGGGG - Intergenic
1082132416 11:48506486-48506508 AGGGAAGGGGGAAGGGAAGGGGG - Intergenic
1082132433 11:48506521-48506543 AGGGAAGGGGGAAGGGAAGGGGG - Intergenic
1082132439 11:48506533-48506555 AGGGAAGGGAGAAGGGAAGGGGG - Intergenic
1082565867 11:54677082-54677104 AGGGAAGGGAGAAGGGAAGGGGG - Intergenic
1082819845 11:57537502-57537524 GTGGAAGAGGGAGAGGAAGGGGG + Intergenic
1082880722 11:58034778-58034800 AAGGAAGGGAGAAAGGAGGGAGG - Intronic
1082891043 11:58139058-58139080 GAGGAAGGAAGAAAGGAAGAGGG + Intronic
1083336501 11:61924769-61924791 GAAGAAGGGAGGAAGGAAGGAGG + Intergenic
1083389166 11:62335433-62335455 GGGGAAGGGCAAAGGGAAGAAGG - Intergenic
1084187512 11:67482608-67482630 GAGGAAGAGGGAAAGAAAGGTGG - Intergenic
1084286177 11:68132526-68132548 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
1084545694 11:69813968-69813990 GTGAAAGGATGGAAGGAAGGAGG + Intronic
1084859529 11:72009220-72009242 GTTGAAGGGCAGGAGGAAGGTGG + Intronic
1084906774 11:72354594-72354616 GTGGGAGGGAGGGAGGAAGGTGG - Intronic
1085311401 11:75519077-75519099 GAGGAAGGCGGAAAGGCAGGTGG - Intronic
1085358384 11:75861426-75861448 GTGGAAGCGGGGAAGGAAGAAGG + Intronic
1085633375 11:78138656-78138678 GAGGAAGGATGAAGGGAAGGCGG + Intronic
1085713205 11:78848829-78848851 GAGGAAGGAAGGAAGGAAGGAGG + Intronic
1086342120 11:85857385-85857407 CTGGAAGGGCGAAACAGAGGAGG + Intronic
1086518670 11:87645864-87645886 AAGGAAGGGAGAAGGGAAGGGGG - Intergenic
1086518679 11:87645888-87645910 AGGGAAGGGAGAAGGGAAGGGGG - Intergenic
1086518715 11:87645986-87646008 AAGGAAGGGGGAAGGGAAGGGGG - Intergenic
1086518767 11:87646107-87646129 GGGGAAGGGGGAAAGGGAAGGGG - Intergenic
1086974811 11:93119486-93119508 GAGGAAGAGAGAAAGGATGGTGG + Intergenic
1087169132 11:95032488-95032510 GAGGAAGGGAGAGAGGCAGGGGG + Intergenic
1087188531 11:95229959-95229981 GGGGAAGGGCGAGAGGGATGGGG - Intronic
1087254555 11:95939499-95939521 GTGACAGGGTGAAAGAAAGGCGG - Intergenic
1087607549 11:100394941-100394963 GAGGAAGGGGGAAAGGTTGGGGG - Intergenic
1087774323 11:102243565-102243587 GGGGAAGGGGGAAGGGAAGGGGG + Intergenic
1088116027 11:106315892-106315914 GAGGAAGGGAGAGAGGAAGGAGG - Intergenic
1088483505 11:110319313-110319335 GTGGAAAGGGTGAAGGAAGGAGG + Intergenic
1088967584 11:114739340-114739362 GAGGGAGGGAGAGAGGAAGGGGG - Intergenic
1089100400 11:115958187-115958209 GAGGAAGGAGGAAGGGAAGGAGG - Intergenic
1090176015 11:124650392-124650414 GTGGAAGGGAAAAAGCAAGGAGG + Intronic
1090310750 11:125735592-125735614 GCGGAAGGTGAAAAGGAAGGAGG - Intergenic
1090395358 11:126414926-126414948 GGGGAAGAGAGGAAGGAAGGTGG - Intronic
1090611819 11:128478272-128478294 GAGGAAGGGAGGAAGGAGGGAGG + Intronic
1090744189 11:129693641-129693663 GGGGAAGAGGGAAGGGAAGGGGG + Intergenic
1091335148 11:134761031-134761053 GAGGAAGGGAGGGAGGAAGGAGG - Intergenic
1091702699 12:2674355-2674377 GAGGAAGGGGAAGAGGAAGGAGG + Intronic
1091723092 12:2827394-2827416 GGGGAAGAGCAAAAGGCAGGTGG - Intronic
1091953503 12:4615664-4615686 GTGGAAGTGAGAAAGAAGGGCGG + Exonic
1092084921 12:5748844-5748866 GGTGAAGGGAAAAAGGAAGGGGG - Intronic
1092370876 12:7915906-7915928 GGGGAAGGGGGAGGGGAAGGGGG - Intergenic
1092450036 12:8593339-8593361 GGGGAAGGGAGAAAGGAGGGAGG + Intergenic
1093318293 12:17678953-17678975 GAGGGAGGGAGGAAGGAAGGAGG + Intergenic
1093669990 12:21862386-21862408 GTGGAGAGGCAAGAGGAAGGGGG - Intronic
1094089309 12:26630302-26630324 GTGGAAAGTAGAAAGAAAGGAGG + Intronic
1095174715 12:39078317-39078339 AAGGAAGGGAGAAAGGAAGGAGG + Intergenic
1095300413 12:40578093-40578115 GTGGAGGGGAGAAAAGAAGGAGG - Intergenic
1095448263 12:42303441-42303463 GGGGAAGGGAGGAAGGAAGGAGG + Intronic
1095796288 12:46222416-46222438 GTGGAAGTGAGCATGGAAGGAGG - Intronic
1095903417 12:47352461-47352483 AAGGAAGGAAGAAAGGAAGGAGG + Intergenic
1095942273 12:47735050-47735072 GGGGAAGGAGGAAAGGAGGGGGG + Intronic
1096079202 12:48822672-48822694 GTGGAAGGAAGAAAAGTAGGGGG + Intronic
1096786817 12:54021649-54021671 CTTGAAGGGCGGGAGGAAGGTGG - Intronic
1096849488 12:54426573-54426595 GAGGAAAGGAGAAAGGAAAGGGG + Intergenic
1096944194 12:55386011-55386033 GAGGAAGGAAGGAAGGAAGGAGG - Intergenic
1097955557 12:65482029-65482051 GAGGAAGGAGGAGAGGAAGGAGG - Intronic
1098041650 12:66359076-66359098 GTGGAATGGAGATAGCAAGGAGG - Intronic
1098219115 12:68249838-68249860 GTGAAAGGGCGGAAGAAAGCAGG - Intronic
1098614539 12:72507061-72507083 GTGGAAGGCAAAGAGGAAGGAGG - Intronic
1099487651 12:83248404-83248426 GTGGAAGGAGAAGAGGAAGGAGG - Intergenic
1099900221 12:88698458-88698480 GTGGACAGGAGAAGGGAAGGTGG - Intergenic
1100214405 12:92432961-92432983 GTGGAAGGCAAAGAGGAAGGAGG + Intergenic
1100370695 12:93966673-93966695 GTGGAAGGATGAAGGGAGGGAGG - Intergenic
1100402028 12:94240235-94240257 TTAGAAGTGGGAAAGGAAGGAGG - Intronic
1100699485 12:97131028-97131050 ATGGAAGAGGGAAAGAAAGGGGG + Intergenic
1100738568 12:97565558-97565580 GTGAGAGGGAGAGAGGAAGGGGG + Intergenic
1100748050 12:97667271-97667293 GAGGAAGGAAGAAAGGAAGGAGG + Intergenic
1100874018 12:98943628-98943650 GTGGAAGGGGGAATGAAAAGAGG - Intronic
1100980905 12:100161504-100161526 GTGACAGGGTGAAAGAAAGGTGG + Intergenic
1101270498 12:103138743-103138765 TTGGAAGGGTCAAAGGAAAGAGG - Intergenic
1101417897 12:104524571-104524593 GTGGATGGATGAATGGAAGGAGG - Intronic
1101843069 12:108341831-108341853 GAGGAAGAGGGAAAGGGAGGAGG + Intergenic
1101925641 12:108969305-108969327 GGGGGAGGAAGAAAGGAAGGAGG - Intronic
1102261888 12:111447999-111448021 GAGGAAGGGAGAAAGGGAAGAGG - Exonic
1102472575 12:113167949-113167971 GTGCAAGGGCCAAGGGAGGGAGG - Intronic
1102552576 12:113702337-113702359 TTGAAAGGAAGAAAGGAAGGAGG - Intergenic
1102678879 12:114676683-114676705 GGGTTAGGGAGAAAGGAAGGAGG + Intronic
1102682247 12:114698693-114698715 GAGATAGGGAGAAAGGAAGGGGG - Intergenic
1102706066 12:114881609-114881631 GTGAAAGGGAGGAAGGAATGGGG - Intergenic
1102737862 12:115179166-115179188 GGAGAAGGGAGAAGGGAAGGAGG + Intergenic
1102992079 12:117322598-117322620 TAGGAAGGAAGAAAGGAAGGAGG - Intronic
1103045217 12:117730486-117730508 GTGGAAGGGGGAGAGGGAGAGGG - Intronic
1103334242 12:120177341-120177363 GTGGTAGGGGGGAGGGAAGGGGG - Intronic
1103366755 12:120389488-120389510 GAGGAAGGGAGAAGGGAAGAGGG + Intergenic
1103366798 12:120389664-120389686 TAGGAAGGGAGAGAGGAAGGAGG + Intergenic
1103366812 12:120389708-120389730 AAGGAAGGGAGAGAGGAAGGAGG + Intergenic
1103444348 12:120984472-120984494 GTGGGAGAGAGAAGGGAAGGAGG + Intronic
1103676906 12:122663266-122663288 AAGGAAGGGAGGAAGGAAGGAGG - Intergenic
1103937846 12:124485972-124485994 GTGGTAGGGTGAGAGGGAGGTGG - Intronic
1103956806 12:124581986-124582008 GAGGGAGGGAGGAAGGAAGGAGG + Intergenic
1104091467 12:125521300-125521322 GGGGAAGGGGAAGAGGAAGGAGG - Intronic
1104249450 12:127077732-127077754 AAGGAAGGAAGAAAGGAAGGAGG - Intergenic
1104463199 12:128971391-128971413 GAAGAAGGGAGAAAGGAAGGAGG - Intronic
1104876539 12:132038842-132038864 GTGGCAGGGCCACATGAAGGAGG - Intronic
1105274020 13:18904398-18904420 GATGGAGGGCGACAGGAAGGTGG - Intergenic
1105437575 13:20391222-20391244 GGGGTAGGGGGAAAGGGAGGCGG + Intergenic
1105703169 13:22948873-22948895 GATGAAGGAGGAAAGGAAGGAGG + Intergenic
1106080164 13:26493779-26493801 GGGGAAGGGCAATAGGGAGGTGG + Intergenic
1106179373 13:27357978-27358000 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
1106299406 13:28450502-28450524 GAGAAAGGGAGAAGGGAAGGAGG + Intronic
1106833884 13:33613524-33613546 GAGGAAGGGCGAATGGCAGCAGG + Intergenic
1107013688 13:35692222-35692244 GAGGAAGGGAGTAAGGAGGGAGG + Intergenic
1107549134 13:41458354-41458376 GTGGAAGGGCGACGCGAAGTCGG - Exonic
1107888798 13:44896290-44896312 TTGGGAGGGCGGGAGGAAGGAGG - Intergenic
1108048385 13:46404876-46404898 GAGGAAGTGAGAAAGGAAGAGGG + Intronic
1108291047 13:48961424-48961446 GAAGAAGGAAGAAAGGAAGGGGG + Intergenic
1108480713 13:50867473-50867495 AAGGAAGGAAGAAAGGAAGGAGG - Intergenic
1108492380 13:50994244-50994266 GTGGGAAGGAGAAAGGGAGGAGG - Intergenic
1108723700 13:53158834-53158856 GAGGGAGGGAGGAAGGAAGGAGG - Intergenic
1108817584 13:54310935-54310957 GAGGCAGGGAGAAAGGAAAGAGG + Intergenic
1109370712 13:61416218-61416240 AAGGAAGGAAGAAAGGAAGGGGG - Intronic
1109396226 13:61763478-61763500 TAGGAAGGGTGAAAGGAAGCAGG + Intergenic
1109680525 13:65746386-65746408 GTGGAAGGTGGAAGGGAAGCTGG + Intergenic
1110137758 13:72089398-72089420 GTGTAAGGAAGAGAGGAAGGGGG + Intergenic
1110913872 13:80997901-80997923 GTAGAAGGTCAAAAGGAAAGTGG - Intergenic
1111084134 13:83351805-83351827 GAGGAAGGGAGAAAGGAAGGGGG + Intergenic
1111084778 13:83361130-83361152 GAGGAAGGGGTAAAGGAAGATGG + Intergenic
1111483873 13:88869232-88869254 GTGGGAGGCCAAGAGGAAGGAGG - Intergenic
1111696464 13:91630793-91630815 GTGGGAGGAGGAAAGAAAGGGGG + Intronic
1112330418 13:98473266-98473288 AAGGAAAGGGGAAAGGAAGGAGG + Intronic
1112734642 13:102402333-102402355 CTGGAAGAGTGAGAGGAAGGAGG - Intergenic
1112760297 13:102687880-102687902 GTGGAAAGGTTAGAGGAAGGTGG - Intronic
1113110151 13:106814224-106814246 GAGGGAGGGAGGAAGGAAGGAGG + Intergenic
1113319114 13:109214839-109214861 GTGGAAGGTGAAGAGGAAGGGGG + Intergenic
1113326643 13:109288794-109288816 GAGGAAGGGAGGGAGGAAGGAGG + Intergenic
1113382573 13:109817348-109817370 GTGGAGGGGTGAAGGGATGGGGG + Intergenic
1113697253 13:112355107-112355129 GTGGAAGTGAGAAAGGGAAGCGG + Intergenic
1114122674 14:19687512-19687534 GGGGAAGGAAGGAAGGAAGGGGG - Intergenic
1114170027 14:20262880-20262902 GAGGAAGGGCAAAGGGAAGGAGG + Intronic
1114204540 14:20556323-20556345 GGGAAAGGAAGAAAGGAAGGTGG + Exonic
1114428514 14:22640344-22640366 GAGGAAAGGAGGAAGGAAGGGGG + Intergenic
1114461708 14:22890313-22890335 GTGGCAGTGGGAAAGGAAGGAGG + Intergenic
1114662208 14:24354233-24354255 AAGGAAGGAAGAAAGGAAGGAGG - Intergenic
1114710905 14:24777303-24777325 GGGGAGGAGCTAAAGGAAGGTGG + Intergenic
1114876968 14:26732315-26732337 GAGGGAGGGAGGAAGGAAGGAGG - Intergenic
1115006881 14:28496609-28496631 GAGGAAGGGAGAGAGGAAGGAGG - Intergenic
1115146741 14:30235608-30235630 AAGGAAGGGAGGAAGGAAGGAGG - Intergenic
1115419792 14:33181250-33181272 GTGGAAGGAAAAGAGGAAGGAGG + Intronic
1115702855 14:35972278-35972300 AAGGAAGGAAGAAAGGAAGGAGG - Intergenic
1115875596 14:37858028-37858050 GAGGAAGGGAGGGAGGAAGGAGG - Intronic
1115959940 14:38824364-38824386 CTAGAAGGGAGAAAGGGAGGAGG - Intergenic
1116087086 14:40254191-40254213 GAGGAAGGGGGAAAGAAAAGAGG - Intergenic
1116324109 14:43509102-43509124 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
1116397070 14:44459182-44459204 GTGGAAGGTGGAGAGGAAGCAGG - Intergenic
1116485794 14:45446541-45446563 GTGCATGGGGGAAAGGAAGAAGG - Intergenic
1116495473 14:45554763-45554785 GTGGAAGGTGAAGAGGAAGGGGG + Intergenic
1116553376 14:46271113-46271135 GTGGGAGGGAGGAAAGAAGGGGG + Intergenic
1116625554 14:47258343-47258365 GTGGAAGGCGGAGAGGAAGGAGG + Intronic
1116957907 14:50943461-50943483 GTGGAAGGGCTAAGGGTCGGGGG + Intronic
1117035271 14:51721740-51721762 AAGGAAGGGAGGAAGGAAGGAGG + Intronic
1117302758 14:54444714-54444736 GTGGAAGGTGGGAAGGAAAGGGG + Intergenic
1117517641 14:56518341-56518363 GAGGGAGGAAGAAAGGAAGGAGG - Intronic
1117698371 14:58389209-58389231 AGGGAAGGAAGAAAGGAAGGAGG + Intergenic
1117987020 14:61396745-61396767 GTGGAGGTGCTAAAGGTAGGGGG + Intronic
1118208488 14:63745467-63745489 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
1118564999 14:67129838-67129860 GAGGAAGGAAGGAAGGAAGGCGG + Intronic
1118660638 14:68005965-68005987 GAGGAAGAGAGAGAGGAAGGAGG + Intronic
1118706544 14:68485489-68485511 GTGGAAGGAGGAAAGGTAGCTGG - Intronic
1118993154 14:70813761-70813783 GAGGAAGGGGTGAAGGAAGGAGG + Intergenic
1118994350 14:70822737-70822759 GAGGAGGGGAGGAAGGAAGGAGG - Intergenic
1119235418 14:73015350-73015372 AAGGAAGGGGGAAAGGAAGAGGG + Intronic
1119314378 14:73679516-73679538 GGGGAAGGGCAGAAGGAAAGGGG + Intronic
1119456471 14:74760330-74760352 GAGGAAGGGAGAGAGGAAGGAGG - Intergenic
1119513371 14:75229048-75229070 GTGGAAGGTAGATGGGAAGGAGG + Intergenic
1119577561 14:75740598-75740620 GTGGAGGGGAGAAAGCAAGTAGG - Intronic
1119581185 14:75782802-75782824 CTAGAAGGGTGAAAAGAAGGGGG + Intronic
1119770241 14:77216101-77216123 GAGGAAGGAAGGAAGGAAGGAGG + Intronic
1119922190 14:78456901-78456923 GAGGAAGGAAGGAAGGAAGGAGG - Intronic
1119993622 14:79227786-79227808 GAGGAAGGGAGGAAGGGAGGAGG - Intronic
1120005687 14:79355257-79355279 GAGGAAGGAGGGAAGGAAGGGGG - Intronic
1120327643 14:83050672-83050694 GTGGAAGGCAGAAAGGGAAGGGG - Intergenic
1120763076 14:88303485-88303507 GTGAAAGGCCTAAAGGAATGAGG + Intronic
1120948590 14:90020632-90020654 GAGGGAGGGAGGAAGGAAGGCGG - Intronic
1121473676 14:94174960-94174982 GGGGGGGGGCGGAAGGAAGGGGG - Intronic
1121741817 14:96257945-96257967 GAGGAAGGAAGGAAGGAAGGAGG + Intronic
1121788154 14:96678402-96678424 GTGGAAGGCAAAGAGGAAGGAGG - Intergenic
1121882570 14:97514268-97514290 GAGGAAGGAAAAAAGGAAGGAGG - Intergenic
1121882619 14:97514438-97514460 GAGGAAGGAAGGAAGGAAGGAGG - Intergenic
1121935439 14:98014097-98014119 AAGGAAGGAAGAAAGGAAGGAGG - Intergenic
1121957907 14:98230858-98230880 ATGGAAGAGTGGAAGGAAGGTGG + Intergenic
1122039931 14:98979918-98979940 GTGGAAGGTGAAGAGGAAGGAGG - Intergenic
1122227337 14:100287369-100287391 GTGGAAGGGCAGAGAGAAGGGGG - Intergenic
1122253899 14:100462950-100462972 GAGCAAGGGGGAGAGGAAGGGGG - Intronic
1122253915 14:100463005-100463027 GAGCAAGGGGGAGAGGAAGGGGG - Intronic
1122546021 14:102523360-102523382 GTGGCAGGAAGGAAGGAAGGAGG + Intergenic
1122655004 14:103252465-103252487 GTGGGAGGGTGAAGGGGAGGTGG + Intergenic
1122874096 14:104655258-104655280 ATGGAAGGAAGGAAGGAAGGAGG + Intergenic
1122915128 14:104855016-104855038 GTGGAGGGGTGAATGGAGGGGGG + Intergenic
1122915138 14:104855040-104855062 GTGGAGGGGTGAATGGAGGGGGG + Intergenic
1122915156 14:104855088-104855110 GTGGAGGGGTGAATGGAGGGGGG + Intergenic
1122915175 14:104855136-104855158 GTGGAGGGGTGAATGGAGGGGGG + Intergenic
1122915216 14:104855277-104855299 GTGGAAGGATGAATGGAGGGGGG + Intergenic
1122915250 14:104855370-104855392 GTGGAGGGGTGAATGGAGGGGGG + Intergenic
1122915282 14:104855487-104855509 GTGGAAGGATGAATGGAGGGGGG + Intergenic
1122915291 14:104855511-104855533 GTGGAAGGGTGAATGGAGGGGGG + Intergenic
1123392894 15:19895219-19895241 GAGGAAGGAAGAAAGAAAGGTGG - Intergenic
1124603812 15:31155689-31155711 GAAGAAGGGAGAAAGGGAGGGGG + Intronic
1125242037 15:37586941-37586963 GGGGAAAGGGAAAAGGAAGGTGG - Intergenic
1125248410 15:37670998-37671020 TTGGAAGAGCGAATGTAAGGAGG - Intergenic
1125255492 15:37758441-37758463 GAGGGAGGGAGGAAGGAAGGAGG + Intergenic
1125697480 15:41651593-41651615 GGGGAAAAGGGAAAGGAAGGAGG - Intronic
1126379721 15:48033831-48033853 ATGGGAGGGAGAAAGGAAGATGG + Intergenic
1126547188 15:49886391-49886413 ATGGAAGGAAGAAAGGAGGGAGG + Intronic
1126669232 15:51101190-51101212 GCTGAAGGACGAAAGGGAGGAGG - Intronic
1126695764 15:51323948-51323970 GTGCCAGGGCGGAAGGGAGGAGG + Intronic
1126777015 15:52109094-52109116 ATGGAAGGGGGAGAGGAAGGAGG + Intergenic
1127070228 15:55281714-55281736 AAGGAAGGGAGAAGGGAAGGGGG + Intronic
1127117026 15:55738893-55738915 AAGGAAGGGGGAAGGGAAGGGGG + Intronic
1127337042 15:57997950-57997972 GTTGAAGGGACAAAGAAAGGAGG + Intronic
1127566549 15:60194826-60194848 GTGGAAAGGGAAAAGGAGGGGGG - Intergenic
1127666063 15:61148227-61148249 GTGGAAGGGAAACAGGAAGTGGG + Intronic
1127981937 15:64041837-64041859 GTGGAAGGGAGAGAGGCAGGCGG - Intronic
1128058469 15:64718324-64718346 GAGGAAGGACGGAAGGAAGTAGG + Intergenic
1128682984 15:69664916-69664938 GAGGCAGGTAGAAAGGAAGGTGG + Intergenic
1128705016 15:69832273-69832295 AGGGAAGGGAGAAGGGAAGGGGG + Intergenic
1129044878 15:72725765-72725787 GAGGAAGGGGAAGAGGAAGGGGG - Intronic
1129715525 15:77846385-77846407 GTGGAAGGCAAAGAGGAAGGAGG - Intergenic
1129933018 15:79428165-79428187 GAGGGAGGGAGGAAGGAAGGAGG - Intergenic
1130359268 15:83166732-83166754 GTGGAAGGTGAAGAGGAAGGAGG + Intronic
1130395155 15:83494965-83494987 CTGGAAGGGGGAGAGGGAGGAGG - Intronic
1130445260 15:83994951-83994973 GTGGAAGGGAGGAAGCAAGCAGG + Intronic
1130553471 15:84906626-84906648 AAGGAAGGAAGAAAGGAAGGAGG - Intronic
1130862293 15:87901731-87901753 GAGAAAGGAAGAAAGGAAGGAGG + Intronic
1130924661 15:88375900-88375922 AAGGAAGGGAGGAAGGAAGGAGG - Intergenic
1130952928 15:88606223-88606245 AAGGAAGGGAAAAAGGAAGGGGG - Intergenic
1131014160 15:89043533-89043555 GGGGAAGGGAAAGAGGAAGGAGG + Intergenic
1131166960 15:90149042-90149064 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
1131213293 15:90516309-90516331 AAGGAAGGAAGAAAGGAAGGAGG + Intergenic
1131651950 15:94409871-94409893 GAGGGAGGGGGAAAGGGAGGGGG - Intronic
1131701647 15:94943025-94943047 GGGGAAGGGTGGAGGGAAGGGGG + Intergenic
1131857166 15:96609855-96609877 GAGGGAGGGAGGAAGGAAGGAGG - Intergenic
1132854383 16:2038405-2038427 GGGGAAGGGGGAGGGGAAGGGGG - Exonic
1133083813 16:3345832-3345854 GAGGGAGGGAGGAAGGAAGGAGG - Intergenic
1133158460 16:3892530-3892552 AAGGAAGGGAGGAAGGAAGGAGG - Intergenic
1133444002 16:5844584-5844606 GTCCAAGGGAAAAAGGAAGGGGG + Intergenic
1133495915 16:6317236-6317258 GAGGGAGGGCTAAAGGAGGGTGG - Intronic
1133556419 16:6910356-6910378 GTGGAAGGGAAATAGGAAGATGG - Intronic
1133647156 16:7775172-7775194 AAGGAAGGAAGAAAGGAAGGAGG + Intergenic
1133647161 16:7775192-7775214 AGGGAAGGAAGAAAGGAAGGAGG + Intergenic
1133647190 16:7775314-7775336 GTAAAAGGAAGAAAGGAAGGAGG + Intergenic
1133819390 16:9223078-9223100 GTGGAAGGCGAACAGGAAGGAGG - Intergenic
1133839249 16:9394005-9394027 GGGGAAGGGAGACAGGAAGGGGG - Intergenic
1133862036 16:9605216-9605238 GAGAGAGGGCGAAAGGAAGGAGG - Intergenic
1133875915 16:9734158-9734180 GAGGAAGGGAGGAAGGAAGGAGG + Intergenic
1134235032 16:12459007-12459029 GAGGAAGGGAGAAAGGGAGGAGG - Intronic
1134760058 16:16706277-16706299 ATGGAAGGAAGGAAGGAAGGAGG + Intergenic
1134770617 16:16806079-16806101 GGGGAAGGGGGAGAGGAAGGGGG - Intergenic
1134986013 16:18652928-18652950 ATGGAAGGAAGGAAGGAAGGAGG - Intergenic
1135191676 16:20359582-20359604 GTGGAAGGAAGAAGGGAGGGAGG + Intronic
1135480770 16:22818834-22818856 GAGGGAGGGAGGAAGGAAGGAGG - Intronic
1135480820 16:22818987-22819009 GAGGGAGGGAGGAAGGAAGGAGG - Intronic
1135480879 16:22819172-22819194 GAGGAAGGGAGGAAGGAAGGAGG - Intronic
1135627165 16:24006053-24006075 GAGGAAGGGAGGAAGGGAGGTGG - Intronic
1135770446 16:25214341-25214363 AAGGAAGGGAGAAAGGAAGGAGG - Intergenic
1135913135 16:26579179-26579201 GAGGGAGGGAGGAAGGAAGGAGG - Intergenic
1135938798 16:26803265-26803287 GAGGGAGGGAGAAAGGAAGAAGG + Intergenic
1136065160 16:27753770-27753792 AAGGAAGGAGGAAAGGAAGGAGG - Intronic
1136065163 16:27753782-27753804 GAGGAAGGAAGGAAGGAAGGAGG - Intronic
1136080983 16:27852520-27852542 GTGGAAGGGTCAGAGGGAGGAGG + Intronic
1136342966 16:29656905-29656927 GTGGAAGGGCAGAAGCAACGTGG + Intergenic
1136501127 16:30670054-30670076 GAGGAGGGGCTCAAGGAAGGGGG + Exonic
1136698182 16:32105428-32105450 GAGGAAGGGAGAAAGGCAGGAGG + Intergenic
1136798681 16:33048717-33048739 GAGGAAGGGAGAAAGGCAGGAGG + Intergenic
1136985802 16:35103113-35103135 CTGGAAGGGAGATAGAAAGGAGG - Intergenic
1137242893 16:46673417-46673439 CTGGAAGGGAGATAGAAAGGAGG + Intronic
1137773976 16:51040734-51040756 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
1137801021 16:51262151-51262173 AGGGAAGGGGGGAAGGAAGGAGG - Intergenic
1138111867 16:54330428-54330450 GAGGAAGAGAGAAAGGAAAGAGG - Intergenic
1138218529 16:55227330-55227352 GAGGGAGGGAGAAAGGGAGGTGG - Intergenic
1138354584 16:56367125-56367147 GTGGAAGGACAGAAGGAAGCTGG - Intronic
1138506257 16:57479804-57479826 GAAGAAGGGCGGGAGGAAGGAGG - Intronic
1138856095 16:60694671-60694693 GTGCAGGGGTGAGAGGAAGGTGG + Intergenic
1139818644 16:69700180-69700202 AAGGAAGGGAGAAAGGAGGGAGG - Intronic
1140337702 16:74125008-74125030 GTGGAAGGGGGAGAGGAGAGAGG - Intergenic
1140393452 16:74607526-74607548 ATGGAAGGAAGGAAGGAAGGAGG - Intergenic
1140609574 16:76581828-76581850 GTGGAAGCGCAAGAGGAAGCAGG - Intronic
1140641952 16:76985235-76985257 GTGGAAAGGGGAAGGGAAGAGGG - Intergenic
1140778953 16:78276196-78276218 GAGTAAGAGCCAAAGGAAGGAGG - Intronic
1140914687 16:79483137-79483159 GTGGAAGGGGGGAGGGAGGGAGG - Intergenic
1141164320 16:81650371-81650393 CTGGAAGGAGGAAAGAAAGGTGG + Intronic
1141544293 16:84753947-84753969 GTTGAGGGGAGAAAGCAAGGAGG + Intronic
1141598569 16:85112051-85112073 GTGGAGGCGAGAAAGGAAAGGGG + Intronic
1141734673 16:85844277-85844299 GGGGAAGGAAGGAAGGAAGGAGG - Intergenic
1141773021 16:86102320-86102342 GAGGAAGGAAGGAAGGAAGGAGG - Intergenic
1141856258 16:86683222-86683244 GAGGGAGGGAGAGAGGAAGGAGG + Intergenic
1141887715 16:86904061-86904083 GTGGAAGGTGAAGAGGAAGGAGG - Intergenic
1142137807 16:88459690-88459712 GGGGAAGGGGGAAGGGGAGGAGG - Intronic
1203143407 16_KI270728v1_random:1783797-1783819 GAGGGAGGGAGGAAGGAAGGGGG - Intergenic
1203143442 16_KI270728v1_random:1783908-1783930 GAGGGAGGGAGGAAGGAAGGGGG - Intergenic
1142559367 17:800873-800895 GTCCAAGGGCGGAAGGAAGGAGG + Exonic
1142785772 17:2221386-2221408 GTGGAAGGCAAAGAGGAAGGAGG - Intronic
1143204223 17:5131571-5131593 GGGGAAGGGGGAAAGGCATGGGG + Intronic
1143374465 17:6459059-6459081 GTGGAAGGGCCAGACGAAGAGGG - Intronic
1143673721 17:8415088-8415110 GAGGGAGGAAGAAAGGAAGGTGG - Intronic
1143897807 17:10150319-10150341 GCGGAAGGGAGAAAGGAAAACGG - Intronic
1144063180 17:11601330-11601352 GAAGAAGAGAGAAAGGAAGGAGG + Intronic
1144995381 17:19264708-19264730 GAGGAAGGGAGAGAGAAAGGGGG + Intronic
1145759958 17:27420320-27420342 GGGGAAGGGGGAAAGGCATGGGG + Intergenic
1145799093 17:27672031-27672053 GGGGAAGGGGGAAAGGCATGGGG - Intergenic
1146159919 17:30554244-30554266 GGGGAAGGGGGAAAGGCATGAGG + Intergenic
1146728555 17:35174879-35174901 GCGGAAGGAAAAAAGGAAGGAGG + Intronic
1146820910 17:35983025-35983047 ATGGAAGGATGAAGGGAAGGAGG - Intergenic
1146918359 17:36692607-36692629 GGGGAAGGGTGGGAGGAAGGAGG - Intergenic
1147530194 17:41269070-41269092 ATGGAAGGAAGAAAGGAAGGAGG + Intergenic
1147565421 17:41533313-41533335 AGGGAAGGAGGAAAGGAAGGAGG + Intergenic
1147919534 17:43907407-43907429 GTGTCAGGACGAAAAGAAGGCGG + Intronic
1148549183 17:48540158-48540180 GAGGAAGGCAGAAAGCAAGGTGG + Intergenic
1148661625 17:49338440-49338462 GCAGAAGGGCGAAAAGAAGAGGG + Intronic
1148701148 17:49587740-49587762 GTGAAAGTGGGAAAGGATGGTGG + Intergenic
1148760952 17:49999719-49999741 ATGGCAGGGAGAAGGGAAGGGGG + Intergenic
1148801700 17:50231121-50231143 GAGGGAGGGAGGAAGGAAGGAGG + Intergenic
1148849174 17:50546451-50546473 GTGGAAGGGGCAAAGGATGAAGG - Intronic
1149175598 17:53867009-53867031 GTAGAAGGTCAAAAGGAAGCAGG + Intergenic
1149367800 17:55963166-55963188 GAGATAGGGAGAAAGGAAGGGGG - Intergenic
1150293249 17:63993489-63993511 AGGGAAGGAGGAAAGGAAGGAGG + Intergenic
1151133659 17:71924416-71924438 GGGGAAGAGGGAAAGGAGGGAGG + Intergenic
1151249948 17:72826280-72826302 GTGGAAGGTGAAGAGGAAGGAGG - Intronic
1151280740 17:73072332-73072354 GAGGAAGGGGGAAAGGGATGGGG + Intronic
1151403337 17:73870723-73870745 GTGGAAGGGAGAATGGAGTGTGG - Intergenic
1151785147 17:76271765-76271787 GGGGAAGGGGGAATGGAAGCAGG - Intergenic
1152016107 17:77751498-77751520 GTGGGAGGGGGATAGGAAGAGGG - Intergenic
1152243035 17:79170112-79170134 GAGGAAGGAAGGAAGGAAGGAGG + Intronic
1153001793 18:462505-462527 ATGGAAGGGTGAAAGGGAGTTGG + Intronic
1153321164 18:3775478-3775500 GTGGAAGGGGAAAGGGAAGCAGG - Intronic
1153504182 18:5779159-5779181 GTGGCAGAGTGAAAGGAAGTGGG + Intergenic
1153958630 18:10121255-10121277 GCAGAAGGGCGAGTGGAAGGTGG + Intergenic
1155068488 18:22290119-22290141 GTGGAAGGTGGAAAGGGAGGAGG + Intergenic
1155171154 18:23267639-23267661 GAGTCAGGGCGAAGGGAAGGAGG - Intronic
1155536290 18:26821581-26821603 GAGGGAGGGAGAAAGGAATGGGG - Intergenic
1155727008 18:29099278-29099300 GAGGAAGAGAGAAAGGATGGAGG - Intergenic
1155985627 18:32227800-32227822 GTGAACTGGGGAAAGGAAGGAGG + Intronic
1156492099 18:37502374-37502396 GCGGGAGGGAGGAAGGAAGGGGG + Intronic
1156564936 18:38176810-38176832 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
1156710263 18:39935793-39935815 CTGGAAGGCCAAGAGGAAGGAGG + Intergenic
1156740538 18:40322073-40322095 GTGGAAGGGGAAGAGGAAGGAGG - Intergenic
1157015198 18:43703876-43703898 GGAGAAGGGAGAAAGGAGGGAGG - Intergenic
1157119452 18:44895246-44895268 GAGGGAGGGAGGAAGGAAGGGGG + Intronic
1157285502 18:46374684-46374706 GTTGAAGGGGGAAAAGATGGGGG - Intronic
1157327350 18:46678683-46678705 GAGGCAGGGAGAAAGGAAGGAGG + Intronic
1157420885 18:47546708-47546730 GAGGAAGGGTGAAAAGAAGTCGG + Intergenic
1157474553 18:48012909-48012931 ATGGAAGGAAGGAAGGAAGGAGG - Intergenic
1158931482 18:62328200-62328222 GAGGAAGGGAGAGAGGGAGGAGG + Intronic
1159313118 18:66736171-66736193 GAGAAAGAGAGAAAGGAAGGAGG - Intergenic
1159551238 18:69897629-69897651 GAGAAAGAGAGAAAGGAAGGAGG + Intronic
1159942167 18:74416627-74416649 AAGGAAGGTCGAAAGGAAGGGGG - Intergenic
1160054169 18:75464067-75464089 GTGGAAAGGGGAAAAAAAGGGGG - Intergenic
1160156347 18:76436714-76436736 GCGGAAGGGAGAATGGAATGAGG - Intronic
1161130281 19:2584621-2584643 GAGGAAGGAAGGAAGGAAGGAGG + Intronic
1161139666 19:2639899-2639921 GAGGGAGGGAGAAAGGAAGGAGG + Intronic
1161139679 19:2639950-2639972 GAGGAAGGAGGGAAGGAAGGAGG + Intronic
1161139725 19:2640078-2640100 GAGGGAGGGAGGAAGGAAGGAGG + Intronic
1161141646 19:2651413-2651435 GAGGGAGGAAGAAAGGAAGGAGG - Intronic
1161141834 19:2652684-2652706 GTAGAGGAGGGAAAGGAAGGGGG + Intronic
1161307732 19:3577170-3577192 GGGGAAGGGGGGAAGGGAGGAGG - Intronic
1161398840 19:4058875-4058897 CTGGAAGGAGGGAAGGAAGGCGG - Intronic
1161428783 19:4218718-4218740 GGGGAAGGGGGGAGGGAAGGGGG - Intronic
1161705083 19:5816278-5816300 TTGGAGGGGCCAAAGGAAAGGGG - Intergenic
1161803511 19:6429392-6429414 GGAGAAGGGAGAAAGGAAGAGGG + Intronic
1161833363 19:6626991-6627013 AAGGAAGGAAGAAAGGAAGGGGG - Intergenic
1161878069 19:6927234-6927256 GAGGGAGGGAGGAAGGAAGGAGG - Intronic
1161919807 19:7257666-7257688 AAGGAAGGAAGAAAGGAAGGAGG + Intronic
1162153392 19:8660938-8660960 GAGGGAGGGAGGAAGGAAGGAGG - Intergenic
1162180860 19:8867791-8867813 ATGGAAGGACAGAAGGAAGGAGG + Intronic
1162450809 19:10753396-10753418 GTGGGGGGGGGAAGGGAAGGGGG - Intronic
1162879707 19:13648951-13648973 GGGGGAGGGGGGAAGGAAGGAGG + Intergenic
1163004544 19:14389225-14389247 GGGGAAGGGGGAAAGGGAGGGGG + Intronic
1163004583 19:14389296-14389318 GGGGAAGGGGGAAGGGGAGGGGG + Intronic
1163207229 19:15812568-15812590 GAGGAAGGAAGAAAGGAGGGAGG + Intergenic
1163376620 19:16937029-16937051 AAGGAAGGGAGAAAGGAAAGAGG - Intronic
1163766420 19:19165842-19165864 GAGGAAGGGAGAAATGGAGGTGG - Intronic
1164259560 19:23557784-23557806 GTGACAGGGCAAAAGAAAGGTGG - Intronic
1164291860 19:23876774-23876796 GTGAAATGGTGAAAGGGAGGTGG + Intergenic
1164680550 19:30131187-30131209 GGGGAAGGGAGAAGGGGAGGGGG - Intergenic
1164744276 19:30599499-30599521 AAGGAAGGTAGAAAGGAAGGAGG - Intronic
1164757396 19:30700347-30700369 GAGGAAGGAAGGAAGGAAGGAGG - Intronic
1165135071 19:33662659-33662681 GTGGAGGGGCAGGAGGAAGGAGG + Intronic
1165910271 19:39221684-39221706 GTAAAAGAGAGAAAGGAAGGAGG - Intergenic
1165910284 19:39221798-39221820 AGGGAAGGGAGGAAGGAAGGAGG - Intergenic
1166194476 19:41196855-41196877 GTGGATGGAAGGAAGGAAGGAGG + Intronic
1166556428 19:43703108-43703130 AAAGAAGGGAGAAAGGAAGGAGG - Intergenic
1166692758 19:44833562-44833584 GAGGAAGGGAGGGAGGAAGGAGG + Intergenic
1167131911 19:47592431-47592453 GGGGAAGGAGGAAAGGCAGGTGG - Intergenic
1167153929 19:47726592-47726614 GAGGAAGGAAGGAAGGAAGGAGG - Intronic
1167158807 19:47754932-47754954 GTGGGAGGAAGGAAGGAAGGGGG - Intronic
1167216391 19:48168400-48168422 GTGGTAAGGAGAAAGGAACGTGG - Intronic
1167564212 19:50246132-50246154 ATGGAAGGAAGGAAGGAAGGAGG - Intronic
1168097603 19:54124471-54124493 GTGGGAGGGAGGGAGGAAGGGGG - Intronic
1168143935 19:54408635-54408657 GAGGGAGGGAGGAAGGAAGGGGG + Intergenic
1168150950 19:54448450-54448472 CTGGAAGGGCGCAGGGGAGGGGG - Intergenic
1168515782 19:57009278-57009300 ATGGAAGGGTGAATGGATGGGGG - Intergenic
1168515804 19:57009354-57009376 ATGGAAGGGTGAATGGATGGGGG - Intergenic
1168704269 19:58459699-58459721 GAGCAAGAGAGAAAGGAAGGAGG - Intergenic
925394352 2:3521748-3521770 GTGAAGGGCCCAAAGGAAGGAGG - Intergenic
925496208 2:4452453-4452475 GGGGAAGGGGGAAGGGGAGGAGG - Intergenic
925496234 2:4452565-4452587 GAGGAAGGGAGAAGGGGAGGAGG - Intergenic
925507697 2:4586748-4586770 GAGGAAAGGAGAAAGGAAGGAGG - Intergenic
925791157 2:7489022-7489044 AAGGAAGGGAGGAAGGAAGGAGG + Intergenic
925927589 2:8681676-8681698 GGGGAAGGGGGAGGGGAAGGAGG - Intronic
925927594 2:8681688-8681710 GGGGAAGGGGGAGGGGAAGGGGG - Intronic
926244544 2:11113371-11113393 AAGGAAGGAAGAAAGGAAGGAGG - Intergenic
926579088 2:14615157-14615179 ATGGAAGGAAGTAAGGAAGGAGG + Intergenic
926663163 2:15491169-15491191 GAGGAAGGGTGGGAGGAAGGTGG - Intronic
927078454 2:19603523-19603545 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
927107135 2:19837431-19837453 GCAGAAGTGAGAAAGGAAGGGGG - Intergenic
927155411 2:20218356-20218378 GTGGGAGGCAGAAAGGAAGCTGG + Intronic
927562739 2:24084904-24084926 GGGGAAGGAGGAAAGGAAAGAGG - Exonic
927608604 2:24513259-24513281 GTGGAAGGGGTAAAAGAAAGAGG - Intronic
927875967 2:26655317-26655339 GAGGGAGGGGGGAAGGAAGGAGG + Intergenic
928133383 2:28669601-28669623 GTGGAAGAGAAAAAGGAAGAAGG + Intergenic
928172919 2:29014824-29014846 GTAGGAGGGAGGAAGGAAGGAGG + Intronic
928274087 2:29883079-29883101 GAGGAAGGGAGAGAGGAAGGAGG + Intronic
928329747 2:30348547-30348569 TTGGAAGGTCAAAAGGAAAGAGG - Intergenic
928555204 2:32416786-32416808 GGGGAGGGGGGAAAGAAAGGGGG - Intronic
928602359 2:32915973-32915995 GAGGAAGGGAGGGAGGAAGGAGG - Intergenic
928955123 2:36858277-36858299 ATGGAAGGACAAAAGGAAGGGGG - Intronic
929448963 2:42023968-42023990 GAGGGAGGAAGAAAGGAAGGAGG + Intergenic
929468881 2:42170465-42170487 GTGGAATGGAGAAAGGGAAGAGG + Intronic
929584231 2:43103607-43103629 GTGGAAGGAGGAAGGGAAGGGGG + Intergenic
929667803 2:43846888-43846910 CTGGTAGGGAGAAAGAAAGGTGG - Intronic
929778640 2:44943684-44943706 GTGGATAGGCGAAAGGAGTGGGG + Intronic
930002849 2:46872874-46872896 GTGGAAGGTCAAAGGGGAGGTGG + Intergenic
930084056 2:47480206-47480228 GAGGAAGGGGGAAGGGAAGGAGG - Intronic
930084064 2:47480225-47480247 GAGGAAGGGGGAAGGGAAGGAGG - Intronic
930187103 2:48420977-48420999 GTGGAACGGAGAACGGGAGGAGG + Intergenic
930288529 2:49465362-49465384 GTGGAAGGGCAGAGGGAAAGGGG - Intergenic
930310995 2:49739337-49739359 GTGCAAGAGGGAAAGGGAGGAGG + Intergenic
930331458 2:49990337-49990359 GAGGAAAGACAAAAGGAAGGAGG + Intronic
930366519 2:50446420-50446442 AAGGAAGGAGGAAAGGAAGGAGG - Intronic
930539995 2:52693467-52693489 GAGGGAGGGAGAAAGGGAGGAGG + Intergenic
930672944 2:54170737-54170759 TTGGATAGGCAAAAGGAAGGAGG + Intronic
931430873 2:62208200-62208222 AAGGAAGGGGGGAAGGAAGGAGG - Intronic
931430877 2:62208212-62208234 AAGGAAGGGGGAAAGGAAGGGGG - Intronic
931493185 2:62772167-62772189 GAGGAAGGGGGAAAGGAGGAAGG + Intronic
931947340 2:67324805-67324827 AAGGAAGGGGGAAGGGAAGGAGG + Intergenic
932446862 2:71786831-71786853 GTGGAAGGGGGACATGAGGGAGG - Intergenic
932458425 2:71864948-71864970 GAGAAAGGAAGAAAGGAAGGAGG - Intergenic
932759482 2:74430041-74430063 GTGGGAGGAAGAAAGGAGGGTGG + Intronic
933298918 2:80521157-80521179 GAGGAAGGGAGAAAAGAATGGGG - Intronic
933578359 2:84096065-84096087 GAGGAAGGAAGAAAGAAAGGAGG + Intergenic
933811668 2:86036503-86036525 GTGGCAGAGAGGAAGGAAGGGGG + Intronic
934546552 2:95221990-95222012 GTGGAAGGAAGAAAGGAAGAAGG - Intronic
934709869 2:96507954-96507976 GTGGAGGGGCGCAAGGCAGACGG - Intronic
934919892 2:98334347-98334369 GTGGAAGGAATGAAGGAAGGAGG + Intronic
935171488 2:100614014-100614036 GGGGAAGGAAGGAAGGAAGGAGG - Intergenic
935717220 2:105949920-105949942 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
935899326 2:107773887-107773909 GTGGATGGACGGAGGGAAGGAGG - Intergenic
935965053 2:108464732-108464754 ATGGAAGGATGGAAGGAAGGAGG + Intronic
936118816 2:109724514-109724536 ATGGAAGGGGGACAGGTAGGTGG + Intergenic
936233572 2:110724946-110724968 GAGGAAGGGAGGAAGGAAGGAGG + Intergenic
936416716 2:112322140-112322162 GAGGGAGGGAGGAAGGAAGGAGG - Intronic
936537064 2:113320716-113320738 ATGGGAGGGAGAACGGAAGGAGG - Intergenic
936663371 2:114567062-114567084 GAGGATGGGAGATAGGAAGGAGG - Intronic
937227176 2:120376536-120376558 GTGGGAGTGAGAAAGGCAGGAGG - Intergenic
937509939 2:122583699-122583721 GGGAAAGGAAGAAAGGAAGGAGG + Intergenic
937575381 2:123414201-123414223 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
938220659 2:129564464-129564486 CTGGTAGGGAGAAAGGAACGAGG - Intergenic
938319148 2:130351499-130351521 GTGGCAAGGAGAAAGGAGGGAGG - Intergenic
938670385 2:133580980-133581002 GAGGAAGGGAAAGAGGAAGGAGG - Intergenic
939097349 2:137849060-137849082 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
939346626 2:140974595-140974617 TTAGAAGGGAGAAAGGAAGAAGG + Intronic
939428625 2:142073819-142073841 GAGGAAGAGAGAGAGGAAGGAGG - Intronic
939459072 2:142476102-142476124 GAGGAAGAGAGAAAGGAGGGAGG + Intergenic
939644011 2:144674521-144674543 GTGGGAGGGAGAAAGGAAAATGG - Intergenic
939733886 2:145819420-145819442 GAGGGAGGGAGAAAGGAAGGAGG - Intergenic
939897648 2:147810994-147811016 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
940014293 2:149087224-149087246 GGGGAAGGGAGAAGGGAAAGTGG - Intronic
940115518 2:150204215-150204237 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
940777333 2:157898413-157898435 GAGGAAGGAAGGAAGGAAGGAGG + Intronic
940829714 2:158454257-158454279 GTGGTAGGGTAGAAGGAAGGTGG + Intronic
941088004 2:161141471-161141493 GTTGAGGGGCAAGAGGAAGGAGG - Intronic
941134825 2:161701722-161701744 TAGGAAGGGTAAAAGGAAGGGGG - Intronic
941311615 2:163939564-163939586 GGGGAAGGGAGAAAGGAGAGAGG + Intergenic
941334787 2:164228814-164228836 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
941339325 2:164287029-164287051 GAGGAAGGAAGAAAGGAAGGAGG + Intergenic
942045499 2:172097157-172097179 GTGAAGGGGCCAGAGGAAGGGGG - Intergenic
942151708 2:173082369-173082391 GATGAAGGGTGAAAGGAATGGGG - Intronic
942211780 2:173678322-173678344 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
942329395 2:174806127-174806149 GGGGGAGGGAGTAAGGAAGGTGG + Intronic
942629393 2:177939369-177939391 GAGGAAGGGAGGAAGGAAGGAGG + Intronic
942897673 2:181076940-181076962 GTGGAGGGAAGAAAGGAAGAAGG - Intergenic
943879192 2:193117299-193117321 GTGGACAGGAGAAAGAAAGGGGG + Intergenic
945049281 2:205807809-205807831 GTGGGAGGGCGGCAGGAGGGAGG - Intergenic
945247227 2:207729668-207729690 AAGGAAAGGGGAAAGGAAGGAGG - Intronic
945463613 2:210141126-210141148 AGGGAAGGGAGGAAGGAAGGAGG - Intronic
945598321 2:211824167-211824189 GGGGAAGGATGAAAGGAAGTAGG - Intronic
945911183 2:215651444-215651466 AGGGAAGGAAGAAAGGAAGGAGG + Intergenic
946183113 2:217960736-217960758 GTGGTAGGGAGACTGGAAGGGGG - Intronic
946229298 2:218281910-218281932 CTGGAAGGGCAGATGGAAGGTGG - Intronic
946437626 2:219668415-219668437 ATGGAAGAGCAAAAGGAAGCCGG - Intergenic
946579783 2:221115849-221115871 GAGGAAGGGAGAGAGGAATGAGG - Intergenic
946853194 2:223927921-223927943 GGGAAAGGGGGAAAGGAGGGAGG + Intronic
947030131 2:225783270-225783292 GTGGAAAGGGGAAAGGAAGGAGG - Intergenic
947042765 2:225942458-225942480 GAGGGAGGGCGAGAGGAAGGAGG + Intergenic
947077358 2:226359793-226359815 GAGGAAGGGAGAAAGGAGGGAGG + Intergenic
947077768 2:226364049-226364071 CAGGAAGGGAGAGAGGAAGGAGG + Intergenic
947367144 2:229408420-229408442 GGGGAAGGGAGAGAGGGAGGAGG - Intronic
947620590 2:231588173-231588195 GAGGGAGGGAGGAAGGAAGGAGG + Intergenic
947624823 2:231612908-231612930 CTGGGAGGGAGAAGGGAAGGGGG + Intergenic
947742138 2:232489549-232489571 GAGGGAGGGCAAAAGGAGGGAGG - Intergenic
947868924 2:233421633-233421655 CTGGAAGGAAGCAAGGAAGGAGG - Intronic
947909177 2:233790450-233790472 GAGGGAGGGAGGAAGGAAGGGGG - Intronic
947909186 2:233790469-233790491 GAGGGAGGGAGGAAGGAAGGAGG - Intronic
947991273 2:234489405-234489427 GGGGAAGGGGGAGGGGAAGGAGG + Intergenic
948149568 2:235734309-235734331 CTGGAAGGGAGAAAGACAGGAGG - Intronic
948289923 2:236817269-236817291 AAAGAAGGGAGAAAGGAAGGAGG - Intergenic
948695652 2:239732009-239732031 GTGGAGGGGAGGAAGGAGGGTGG - Intergenic
948711571 2:239828755-239828777 ATGGAAGGGCCACAGGACGGAGG + Intergenic
948711585 2:239828798-239828820 ATGGAAGGGCCACAGGACGGAGG + Intergenic
1168923848 20:1563685-1563707 GTGGAAGGAGAAAAGGAAGCAGG + Exonic
1168973194 20:1945009-1945031 TGGGAAGGAAGAAAGGAAGGGGG + Intergenic
1169217983 20:3804374-3804396 GTGGGGAGGCGGAAGGAAGGAGG - Intronic
1169541630 20:6606112-6606134 GGGGAAGGGAAAAGGGAAGGAGG - Intergenic
1169572268 20:6919278-6919300 GTGGAAAGGAGAAAGCAAGGAGG + Intergenic
1169833121 20:9847243-9847265 GTGGAAGGCAAAGAGGAAGGAGG - Intergenic
1169918389 20:10706540-10706562 GTGGAATGAGGAAAGGATGGTGG + Intergenic
1170355766 20:15490201-15490223 GAGGAAGGAAGGAAGGAAGGGGG - Intronic
1170392704 20:15892499-15892521 GAGGAATGGAGAAAGGAATGGGG - Intronic
1170417674 20:16161637-16161659 GAGGAAGAGTGAAAGGAAGGGGG + Intergenic
1170501814 20:16982435-16982457 GAGGAAGGGAGAAAAGCAGGAGG - Intergenic
1170581229 20:17701010-17701032 GTGTAAGGTAGAAAGGGAGGTGG + Intronic
1170604044 20:17862837-17862859 GAGAAAGGGAGGAAGGAAGGAGG + Intergenic
1170867693 20:20174666-20174688 GTGGAGGAGAGAAAGGAGGGTGG + Intronic
1170904650 20:20502667-20502689 GTGGTAGGGAGAGAGTAAGGTGG + Intronic
1171136699 20:22701265-22701287 GTGGAGGTCCTAAAGGAAGGTGG + Intergenic
1171437786 20:25136511-25136533 GTGGAAGGGCAAAAGGAGGGAGG - Intergenic
1171497371 20:25565368-25565390 GAGGAAGAGAGAAAGAAAGGAGG + Intronic
1172203759 20:33147383-33147405 GAGGAAGGGAGGAAGGGAGGAGG + Intergenic
1172350567 20:34236136-34236158 GAGGAAAGGAGAAAGGAGGGAGG + Intronic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1172436541 20:34932597-34932619 GGGAAAAGCCGAAAGGAAGGGGG - Intronic
1172558836 20:35867837-35867859 GAGGAAGGAGGAAAGGAAGAGGG - Intronic
1172719524 20:36988909-36988931 GCGGAAGGTGAAAAGGAAGGAGG - Intergenic
1172868199 20:38116187-38116209 AAGGAAGGGAGAAAGGGAGGAGG - Intronic
1172877237 20:38172116-38172138 AGGGAAGGGAGAAAGGAAGAGGG + Intergenic
1173037645 20:39428082-39428104 GGGGGAGGGAGAAAGGGAGGGGG - Intergenic
1173367247 20:42397447-42397469 GGGGAAGGGAGAATGGAGGGTGG - Intronic
1173481899 20:43407883-43407905 GTAGAAGGTGGAGAGGAAGGAGG - Intergenic
1173542402 20:43863979-43864001 GCGGAAGGGAGACAGGAGGGAGG - Intergenic
1173959023 20:47057081-47057103 GAGGAAGGAAGAAAGGAAGGAGG + Intronic
1174015019 20:47480918-47480940 AGGGAAGGAAGAAAGGAAGGAGG - Intergenic
1174051181 20:47768664-47768686 GTGGAAAAGCGGAAGGAACGTGG + Intronic
1174216616 20:48921219-48921241 GAGGAAGGGCGATGAGAAGGCGG - Intergenic
1174264113 20:49318965-49318987 CTTGAAGGGCGGCAGGAAGGTGG + Intergenic
1174595163 20:51678125-51678147 GTGGCAGGGCGGGGGGAAGGGGG + Intronic
1174998909 20:55604428-55604450 GAGGAAGGGAGAGAGGAAAGAGG - Intergenic
1175135222 20:56818387-56818409 GAGGAAGAGGGGAAGGAAGGAGG + Intergenic
1175316111 20:58047814-58047836 GTTCAAGGGAGAAAGAAAGGAGG - Intergenic
1175474910 20:59265361-59265383 GAGGGAGGAAGAAAGGAAGGAGG - Intergenic
1175518155 20:59582120-59582142 GGGGAAGGGCGAAAGGTGGCGGG - Intronic
1175657782 20:60786946-60786968 GAGGAAGGGAGAAAAGAAGAAGG - Intergenic
1175657786 20:60786972-60786994 GAGGAAGGGAGAAAAGGAGGGGG - Intergenic
1175666385 20:60863765-60863787 ATGGAAGGGAGAAAGGAAGGAGG + Intergenic
1175666401 20:60863853-60863875 ATCGAAGGAAGAAAGGAAGGAGG + Intergenic
1175855426 20:62118458-62118480 GTGGAAGGGGGACAGGAGGCAGG + Intergenic
1175973999 20:62701382-62701404 GTGGTGGGGGGAGAGGAAGGAGG - Intergenic
1176034181 20:63028437-63028459 GTGGGAGGGAGGCAGGAAGGAGG - Intergenic
1176182307 20:63756147-63756169 GAGGAAGGGCCAAGGGCAGGTGG - Intronic
1176520198 21:7818483-7818505 GTGGAAGGCGGAAGGGCAGGAGG + Exonic
1177237330 21:18409833-18409855 AAGGAAGGGGGAAAGGAGGGAGG - Intronic
1177786353 21:25675549-25675571 GGGGAAGGAAGGAAGGAAGGAGG + Intronic
1177849887 21:26333502-26333524 GTGGAAGGGGGAAAGAAGAGAGG + Intergenic
1177942239 21:27425162-27425184 GGGGAAGGAAGGAAGGAAGGAGG - Intergenic
1178654224 21:34448495-34448517 GTGGAAGGCGGAAGGGCAGGAGG + Intergenic
1178741582 21:35206750-35206772 GGGGAAGGAAGGAAGGAAGGAGG - Intronic
1178887686 21:36496691-36496713 GTGGAAGGAAGGAAGGGAGGAGG + Intronic
1179066850 21:38032753-38032775 CTGGAAATGAGAAAGGAAGGTGG - Intronic
1179374780 21:40840846-40840868 GTGGACGGGAGGGAGGAAGGTGG + Intronic
1179598279 21:42458174-42458196 GTGGAAGAGGGACTGGAAGGGGG - Intergenic
1180677809 22:17599967-17599989 GGGGAAGGAAGAAAGGGAGGGGG + Intronic
1180894734 22:19321948-19321970 GTGGAATGGTGAAAGGGAAGTGG + Intergenic
1181915906 22:26279676-26279698 GTGCAAGGGTGACAGGAAGCGGG - Intronic
1182038705 22:27219623-27219645 GAGGAAGGAAGGAAGGAAGGAGG - Intergenic
1182477296 22:30583149-30583171 GAGGAAGGCAGGAAGGAAGGAGG + Intronic
1183099992 22:35578166-35578188 ATGGAAGGAAGGAAGGAAGGCGG + Intergenic
1183271401 22:36864837-36864859 GTGGAAGGGAAAAGGGGAGGAGG - Intronic
1183419739 22:37704461-37704483 GGGGAAGGGGGAGGGGAAGGGGG + Intronic
1183687103 22:39367445-39367467 GTGGTAGGGGGAGTGGAAGGAGG + Intronic
1183724235 22:39579579-39579601 GTGGAAGGGCAAAGGGGAGAAGG + Intronic
1183848469 22:40562734-40562756 GGGGAAGGGGGAACGGACGGAGG + Intronic
1184093743 22:42305647-42305669 CTGGAAGGACGAATGGGAGGTGG - Intronic
1184255636 22:43285359-43285381 GGGGAAGGAAGAGAGGAAGGTGG - Intronic
1184598978 22:45531685-45531707 CTGGAAGGGGAAAGGGAAGGAGG - Intronic
1184972181 22:48031830-48031852 GTGGAATGGCCAGAGGAAAGTGG - Intergenic
1185133616 22:49055856-49055878 GAGGAAGGGAGGAAGGAAGAGGG - Intergenic
1185156253 22:49195198-49195220 CTGGGAGGCCGAGAGGAAGGAGG - Intergenic
949810056 3:7997699-7997721 GTGGCAGTGAGAGAGGAAGGAGG + Intergenic
950025755 3:9818960-9818982 GTGGAAGGGCGGATGGGTGGAGG - Intronic
950406418 3:12807957-12807979 GTGGAATGGGGAAAGGAAGAAGG + Intronic
950432177 3:12957163-12957185 GTGGCAGAGTGGAAGGAAGGAGG - Intronic
950768837 3:15294435-15294457 ATGGAAGGGAGGAAGAAAGGAGG - Intronic
951353421 3:21634305-21634327 AGGGAAGGGAGAAAGGAAAGAGG + Intronic
951371310 3:21852784-21852806 ATGGAAGGGAGAAGGGAAGACGG + Intronic
951412231 3:22379350-22379372 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
951520879 3:23609846-23609868 GAGGAAGGGAGAAAGGGAAGCGG + Intergenic
951523404 3:23630460-23630482 GTGGAAGGAAGGAAAGAAGGAGG + Intergenic
951695468 3:25441547-25441569 GGAGAAGGGGGAAAGTAAGGAGG - Intronic
951719142 3:25679633-25679655 GGGGAAGGGCGAGGGGAAAGGGG + Intergenic
951719159 3:25679671-25679693 GGGGGAGGGCGAAGGGAAAGGGG + Intergenic
952089259 3:29864883-29864905 GAGGAAGGAGGGAAGGAAGGAGG + Intronic
952489269 3:33850909-33850931 GCGGAAGAGAGGAAGGAAGGGGG - Intronic
952707855 3:36398477-36398499 AGGGAAGGAAGAAAGGAAGGAGG + Intronic
952707872 3:36398590-36398612 AAGGAAGGAAGAAAGGAAGGAGG + Intronic
952860472 3:37808312-37808334 GTGGAAGGGAGGAAGGGAGTTGG + Intronic
952907668 3:38153186-38153208 GATGAAGGGAGAAGGGAAGGAGG - Intergenic
953030051 3:39173732-39173754 GGTGAAGGGTGGAAGGAAGGAGG - Intergenic
953072457 3:39534910-39534932 GAGGGAGGGAGAAAGGAAGGAGG - Intergenic
953082312 3:39632172-39632194 GAGGAAGGAAGGAAGGAAGGAGG - Intergenic
953353053 3:42230340-42230362 GTGGAGGGGGGAAAGGCGGGTGG + Intergenic
953357453 3:42266724-42266746 GGGGAAGGAAGGAAGGAAGGAGG - Intergenic
953439279 3:42904200-42904222 AAGGAAGGGAGGAAGGAAGGAGG - Intronic
953564639 3:44021402-44021424 GAGGAAGGGGGGAAGGAAGAGGG - Intergenic
954336669 3:49922484-49922506 GAGGAAGGAAGGAAGGAAGGAGG + Intronic
954619736 3:51988698-51988720 ATTGAAGGGGCAAAGGAAGGTGG - Intronic
955058045 3:55473737-55473759 GAGGCAGGGAGAAAGAAAGGAGG + Intronic
955459676 3:59168008-59168030 GAAGAAGGAAGAAAGGAAGGAGG + Intergenic
955470169 3:59278526-59278548 GAGGAAGGGCAAAATGAAAGAGG - Intergenic
955906207 3:63810308-63810330 GTGGGAGGGGGATAGGGAGGAGG - Intergenic
956698933 3:71941985-71942007 GAGGGAGGGAGGAAGGAAGGAGG - Intergenic
957356532 3:79094949-79094971 AAGGAAGGAAGAAAGGAAGGAGG - Intronic
957467119 3:80608238-80608260 AAGGAAGGAAGAAAGGAAGGCGG + Intergenic
957467131 3:80608302-80608324 AAGGAAGGAAGAAAGGAAGGCGG + Intergenic
957467143 3:80608366-80608388 AAGGAAGGAAGAAAGGAAGGCGG + Intergenic
958013695 3:87914059-87914081 GTGGAAGTGGGAAAGGGAGATGG + Intergenic
958047971 3:88307983-88308005 GTGAAAGGAAGAAAGGAAAGAGG - Intergenic
958181598 3:90067551-90067573 AAGGAAGGGAGAAAGGAAAGAGG + Intergenic
958518560 3:95155469-95155491 GTGGAAGGTGAAAAGGAAGCAGG + Intergenic
958609489 3:96406340-96406362 GTGGAAGCGGGAAAAGCAGGAGG + Intergenic
959368107 3:105488740-105488762 GAGGAAGGAGGGAAGGAAGGAGG + Intronic
959578499 3:107960730-107960752 GAGGGAGAGAGAAAGGAAGGGGG + Intergenic
960213408 3:114999130-114999152 GAGGAAGGGGGAAAGGGAGAGGG + Intronic
960328484 3:116326811-116326833 GTGTAAGGGTAAAAGGAAGGTGG - Intronic
960413466 3:117356418-117356440 GAGGAAGGGAGAAAGGACAGAGG + Intergenic
960525434 3:118704823-118704845 GGGGGAGGGAGGAAGGAAGGAGG - Intergenic
960625378 3:119677055-119677077 GGGGAAGGGGGGAAGGAAGAGGG + Intronic
960938749 3:122919984-122920006 GTGGACGGGAGGAAGGAAAGGGG - Intronic
961082104 3:124035174-124035196 GAGGAAGGAGGGAAGGAAGGAGG - Intergenic
961180506 3:124872737-124872759 GAGGGAGGGAGGAAGGAAGGAGG - Intronic
961340136 3:126212324-126212346 ATGGAAGGAGGGAAGGAAGGAGG + Intergenic
961340159 3:126212413-126212435 GAGGAAGGGAGGAAAGAAGGAGG + Intergenic
961635800 3:128331535-128331557 GAGAAGGGGAGAAAGGAAGGGGG - Intronic
962613787 3:137104053-137104075 GTGGGTGGGAGAAAGGATGGAGG + Intergenic
962614154 3:137107762-137107784 TGGGAAAGGAGAAAGGAAGGAGG - Intergenic
963309027 3:143687994-143688016 GAGGAAGGGAGAGAGGGAGGAGG - Intronic
963506686 3:146194727-146194749 GTGACAGGCAGAAAGGAAGGAGG + Intronic
963851647 3:150215970-150215992 ATGGGAGGGGGAAAGGAGGGAGG + Intergenic
963870354 3:150408915-150408937 GTGGGAGGGCGAAGAGGAGGAGG - Exonic
963882820 3:150547026-150547048 ATGGATGGGTGAAAGGGAGGGGG - Exonic
964257855 3:154797461-154797483 TTGGAAAGGTGAAAGAAAGGAGG + Intergenic
964647240 3:158971189-158971211 GAGGAAGGGAGGAAGGGAGGAGG - Intronic
965039070 3:163482785-163482807 AGGGAAGGAAGAAAGGAAGGAGG - Intergenic
965080390 3:164024796-164024818 GAGAAAGGGGGAAAGGAGGGAGG + Intergenic
965546142 3:169918354-169918376 GTGGAAGGGGGAAGGGAGGATGG - Intronic
965954200 3:174348609-174348631 AAGGAAGGAAGAAAGGAAGGAGG + Intergenic
966273764 3:178141195-178141217 GAGGGAGGGAGGAAGGAAGGAGG - Intergenic
966273769 3:178141210-178141232 GTGGAAGGAAGGAAGGAGGGAGG - Intergenic
967266725 3:187698201-187698223 GTGGAGGAGAGAAAGGAAGCAGG + Intergenic
967326874 3:188249794-188249816 GAGGAAGGGAGGGAGGAAGGGGG - Intronic
967345354 3:188449324-188449346 GTGGAAGGGAGAATGGAAGAAGG - Intronic
967445828 3:189565331-189565353 AAGGAAGGAAGAAAGGAAGGAGG - Intergenic
967506249 3:190255957-190255979 GTGGAAGCAGGAAAGGTAGGCGG + Intergenic
967952201 3:194849974-194849996 TAGGAAGGGAGAAAGGAGGGAGG + Intergenic
968020079 3:195378072-195378094 GAGGAAGGGAGGAAGGGAGGAGG + Intronic
968251668 3:197222260-197222282 GTGGAAAGGGGAAAGGAGTGTGG - Intronic
968284497 3:197500149-197500171 GAGGGAGAGAGAAAGGAAGGTGG + Intergenic
968645384 4:1738024-1738046 GTGGGAGGGCGGGAGGAAAGGGG - Intronic
968797728 4:2719760-2719782 GAGGGAGGGAGGAAGGAAGGAGG - Intronic
968959924 4:3738260-3738282 GCGGAAAGGAGACAGGAAGGTGG + Intergenic
968978675 4:3835112-3835134 AAGGAGGGGAGAAAGGAAGGAGG + Intergenic
969278320 4:6152034-6152056 TTGGAAAGGAGAAAGGAAGCAGG + Intronic
969495339 4:7523116-7523138 CTGGAAGGAAGAAAGGGAGGAGG - Intronic
969561379 4:7950434-7950456 GTGGAATGGGGACAGGGAGGGGG - Intergenic
969561404 4:7950517-7950539 GTGGAACGGGGACAGGGAGGGGG - Intergenic
969847402 4:9930137-9930159 GTGGAAGGGAGGAAGGAGAGGGG - Intronic
970252677 4:14132616-14132638 GTGGAAGTACCAAAGGAAAGAGG - Intergenic
970542794 4:17096116-17096138 GAGGAAGGAAGGAAGGAAGGAGG - Intergenic
970559107 4:17265620-17265642 GTGGAAGGGAGAAAAGAATGGGG - Intergenic
970730338 4:19095856-19095878 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
970914950 4:21321870-21321892 AAGGAAGGAAGAAAGGAAGGAGG + Intronic
971005672 4:22371790-22371812 GTGGAAAGGTAAGAGGAAGGAGG - Intronic
971034150 4:22675087-22675109 GAGGAAGGGAGGGAGGAAGGGGG - Intergenic
971343412 4:25790761-25790783 AAGGAAGGGAGGAAGGAAGGAGG + Intronic
971394379 4:26214941-26214963 GAGGAAGGACGGAAGGAAGGAGG + Intronic
971448560 4:26778446-26778468 AGGGAAGGGGGAAGGGAAGGGGG + Intergenic
971651315 4:29279044-29279066 GTGGAAGAAAGGAAGGAAGGAGG - Intergenic
971775557 4:30960091-30960113 AAGGAAGGAAGAAAGGAAGGAGG + Intronic
972573581 4:40331862-40331884 ATGGAAGGGGGAGAGGAAGAGGG + Intergenic
972947538 4:44275342-44275364 GTGGAAAGGAGGAAGAAAGGAGG - Intronic
973029388 4:45316593-45316615 GTGGAAGGGTGAAGGGGATGGGG + Intergenic
973054776 4:45641955-45641977 GTGAAAGGAAGGAAGGAAGGAGG - Intergenic
973331043 4:48910383-48910405 GAGGAAGGAAGGAAGGAAGGAGG - Intergenic
973543173 4:51954352-51954374 GTGGAAGGTGGAGAGGAAAGAGG - Intergenic
973544388 4:51966185-51966207 AGGGAAGGAGGAAAGGAAGGAGG - Intergenic
973739268 4:53903348-53903370 AAGGAAGGAAGAAAGGAAGGAGG + Intronic
974247092 4:59333849-59333871 GTGGAAGAGCAGAAGGAAGGAGG - Intergenic
974319594 4:60329576-60329598 GAGGAAGGGAGGAAGGAGGGTGG + Intergenic
974597694 4:64036632-64036654 GGGGAAGGGGGAGGGGAAGGGGG - Intergenic
974865128 4:67570724-67570746 AAGGAAGGGAGAAAGGAGGGAGG + Intronic
975029625 4:69599558-69599580 GAGGATGGAAGAAAGGAAGGAGG + Intronic
975672944 4:76800039-76800061 AAGGAAGGGAGGAAGGAAGGAGG + Intergenic
975694356 4:76997077-76997099 GAGGAAGGTGGAAAGGAAGGGGG + Intronic
975694616 4:76999427-76999449 GAGGAAGGGAGTAAGTAAGGAGG - Intronic
975804024 4:78093967-78093989 GTGGAAGTGGGAAGGGGAGGGGG - Intronic
976579709 4:86721717-86721739 GGGGAAGGGGGAAGGGGAGGGGG - Intronic
976883209 4:89955532-89955554 GTGGAAGGGGGAGAGGTAGGAGG + Intergenic
977290557 4:95160587-95160609 GAGGAAGGGAGGGAGGAAGGAGG - Intergenic
977293950 4:95191881-95191903 GAGGAGGGGAGAAAGGGAGGAGG - Intronic
977763569 4:100771091-100771113 GTGGGAGGGAGGAAGGAAGGAGG + Intronic
978393264 4:108250242-108250264 GAGGAAGGAAGACAGGAAGGAGG + Intergenic
978454072 4:108868693-108868715 AGGGAAGGAAGAAAGGAAGGAGG + Intronic
979532447 4:121783456-121783478 GTGGGAGTGAGGAAGGAAGGAGG - Intergenic
979956885 4:126964537-126964559 TAGGAAAGGAGAAAGGAAGGAGG + Intergenic
980027484 4:127783069-127783091 GAGGGACGGGGAAAGGAAGGAGG - Intronic
980284806 4:130768613-130768635 GAAGAAGGGGGAATGGAAGGTGG - Intergenic
980702698 4:136453911-136453933 GTGGAAGGTGAAGAGGAAGGAGG - Intergenic
980879718 4:138697533-138697555 GTAGAAGAGAGAGAGGAAGGTGG - Intergenic
980893574 4:138839727-138839749 GTGGGAGGGCGGCAGGAGGGGGG + Intergenic
980940338 4:139268116-139268138 AGGGAAGGGGGAAAGGAAGGGGG + Intronic
981033613 4:140150741-140150763 GTGGAAGGGCGCTAGGGGGGCGG + Intronic
981038412 4:140195925-140195947 GGGAAAGGGAGAAAGGCAGGAGG + Intergenic
981092169 4:140743029-140743051 GAGGAAGGAGGAAAGGAAGGAGG + Intronic
982286438 4:153741066-153741088 GTGGCAGGGCGTAAGGATAGTGG + Intronic
982330696 4:154178878-154178900 GTAGAAGGCAAAAAGGAAGGAGG - Intergenic
982538818 4:156641378-156641400 GGGGAAGGATGGAAGGAAGGAGG + Intronic
983110374 4:163742383-163742405 AAGGAAGGGAGGAAGGAAGGAGG - Intronic
983257021 4:165411356-165411378 GAGGAAGGGCAAAAAGTAGGAGG - Intronic
983372050 4:166872884-166872906 GTGGAATGCAGAAGGGAAGGTGG + Intronic
983435963 4:167715793-167715815 AAGGAAGGAAGAAAGGAAGGAGG + Intergenic
983503144 4:168523260-168523282 GAGGAAGGGAGGAAGGAGGGGGG + Intronic
983504664 4:168539949-168539971 GAGGGAGGGAGAAGGGAAGGGGG - Intronic
983927495 4:173417599-173417621 GAGGAAGGAAGGAAGGAAGGAGG - Intergenic
984322037 4:178208398-178208420 GAAGAAGGGGGAATGGAAGGCGG - Intergenic
984362262 4:178749761-178749783 GTGAGAGGGAAAAAGGAAGGGGG + Intergenic
984762731 4:183376758-183376780 GTGGAAGGGGGACAGGCACGTGG - Intergenic
984911238 4:184676398-184676420 AGGGAAGGGAGAAGGGAAGGGGG - Intronic
984911250 4:184676429-184676451 AGGGAAGGGAGAAGGGAAGGGGG - Intronic
985106958 4:186509395-186509417 GAGGGAGGGAGAAAGGAAGGAGG + Intronic
985273386 4:188216122-188216144 AAGGAAGGGGGGAAGGAAGGGGG - Intergenic
985273431 4:188216253-188216275 AAGGAAGGGGGGAAGGAAGGAGG - Intergenic
985273468 4:188216360-188216382 AAGGAAGGGGGGAAGGAAGGAGG - Intergenic
985336965 4:188906149-188906171 GAGGAAGGAGGAAAGGAAGGGGG - Intergenic
986283981 5:6346529-6346551 AAGGAAGGAGGAAAGGAAGGAGG + Intergenic
986305410 5:6510636-6510658 GTGGAAGGGACAGAGGAAGCAGG + Intergenic
986308235 5:6531501-6531523 GAGGAAGGAAGGAAGGAAGGAGG - Intergenic
986530106 5:8727002-8727024 GAGGGAGGGAGGAAGGAAGGGGG + Intergenic
986631606 5:9779194-9779216 GAGCAAGGGAGAGAGGAAGGAGG - Intergenic
986768532 5:10950126-10950148 GTGGAATGGACAGAGGAAGGAGG + Intergenic
986879077 5:12147793-12147815 AGGGAAGGAGGAAAGGAAGGAGG - Intergenic
987163830 5:15173328-15173350 GAGGAAGGGAGAAAGGAGGCAGG + Intergenic
987460390 5:18202073-18202095 GAGTAAGAGAGAAAGGAAGGAGG - Intergenic
987783167 5:22465038-22465060 GGGGAAGGGAGGAAGGGAGGGGG + Intronic
988225997 5:28412028-28412050 GTGGAAGGGTGGAAAGAAAGTGG + Intergenic
988623638 5:32848441-32848463 GGGGAAGGGGGGAAGGAGGGAGG - Intergenic
988858810 5:35255678-35255700 AGGGAAGGAAGAAAGGAAGGAGG - Intergenic
989028432 5:37092116-37092138 GTGACAGGGCGAAAGAAAGGCGG - Intergenic
989165788 5:38432473-38432495 GTGGAAGGGAGGAAGGGTGGGGG + Intronic
989331363 5:40262814-40262836 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
989343572 5:40404277-40404299 GTGGAAGGTGAAGAGGAAGGAGG - Intergenic
989770614 5:45140222-45140244 GTGGAAGGCAAAGAGGAAGGAGG - Intergenic
989784089 5:45305871-45305893 GAGGAAGGAAGGAAGGAAGGTGG + Intronic
990295490 5:54397702-54397724 ATGGAAGGAAGGAAGGAAGGAGG - Intergenic
990572662 5:57094777-57094799 GTGGAAGTGGGAAAGGGAGATGG + Intergenic
990620584 5:57554850-57554872 GTCGATGGGAGAAAGGGAGGTGG + Intergenic
990628383 5:57640365-57640387 AAAGAAGGGAGAAAGGAAGGAGG - Intergenic
990829947 5:59944783-59944805 GTAGAAAGGGGAAAGGAAGATGG - Intronic
990969261 5:61485079-61485101 GAGGAAGGGGGAAAAGAGGGAGG - Intronic
991260971 5:64667660-64667682 AAGGAAGGGAGAAAAGAAGGAGG + Intergenic
991660556 5:68946489-68946511 GGGGATGGCTGAAAGGAAGGAGG - Intergenic
991773659 5:70062830-70062852 AAGGAAGGAAGAAAGGAAGGAGG + Intronic
991852953 5:70938254-70938276 AAGGAAGGAAGAAAGGAAGGAGG + Intronic
991974723 5:72174904-72174926 GGGGAAGGAGGGAAGGAAGGAGG - Intronic
991975161 5:72177950-72177972 AGGGAAGGGAGGAAGGAAGGAGG - Intronic
992268925 5:75046234-75046256 CTGGAAAGGCTAAAGGAAGAAGG + Intergenic
992578975 5:78151839-78151861 GGGGAAGGGGGAGGGGAAGGGGG - Intronic
992629866 5:78669545-78669567 AAGGAAGGAAGAAAGGAAGGAGG + Intronic
992737884 5:79742148-79742170 GAGGAGGGGGGAAAGGAAGAGGG - Intronic
994202036 5:96988122-96988144 GAGGAAGGAAGAAAAGAAGGGGG - Intronic
994443011 5:99835091-99835113 GAGGGAGGGAGGAAGGAAGGAGG + Intergenic
994443018 5:99835110-99835132 GAGGGAGGGAGGAAGGAAGGAGG + Intergenic
994660527 5:102648408-102648430 GTGGGAGGGTGAAGGGGAGGTGG + Intergenic
994731636 5:103498696-103498718 GAGGGAGGGAGGAAGGAAGGTGG + Intergenic
994815110 5:104576182-104576204 GAGACAGGGAGAAAGGAAGGAGG - Intergenic
995381826 5:111543823-111543845 GAGGAAGGCAGGAAGGAAGGAGG - Intergenic
995554085 5:113309874-113309896 AAGGAAGGAAGAAAGGAAGGGGG - Intronic
996416629 5:123217748-123217770 GAGGGAGGGAGAAAGGGAGGAGG + Intergenic
996512674 5:124334696-124334718 AAGGAAGGAAGAAAGGAAGGAGG + Intergenic
996544099 5:124659442-124659464 GTGGCAGGAGCAAAGGAAGGAGG + Intronic
997646539 5:135485940-135485962 TTGGGAAGGGGAAAGGAAGGTGG - Intergenic
997732066 5:136188876-136188898 GTGGGAGGGCAAAGGGCAGGAGG + Intergenic
997868857 5:137489290-137489312 GTGGAAGGGGAAAAGGTAAGGGG + Intronic
998002324 5:138635030-138635052 AAGGAAGGAAGAAAGGAAGGAGG + Intronic
998333159 5:141347051-141347073 GAGGAAGGAAGGAAGGAAGGAGG - Intronic
998871933 5:146561308-146561330 GAGGAAGGGAGACAGGGAGGCGG - Intergenic
998929316 5:147163136-147163158 GAAGAAGGGGGAAGGGAAGGCGG - Intergenic
999275126 5:150325106-150325128 GAGGGAGGGAGAAAGGAAGGAGG + Intronic
999397597 5:151239919-151239941 TTGGAGGGGCAAAAGGAAGAGGG + Intronic
999768636 5:154757869-154757891 GAGGAAGGGGGAAGGGGAGGAGG - Intronic
999886348 5:155927492-155927514 GTGGAAGGGTGTAAGGAAGCAGG + Intronic
1000115340 5:158148819-158148841 GAGGGAGGGAGAAAGGAAGCAGG - Intergenic
1000621281 5:163489433-163489455 GGGGGAGGGGGAAAGGAGGGCGG - Intronic
1000727020 5:164784388-164784410 GGGGAAGGGGGAAGGGAAAGGGG + Intergenic
1000984834 5:167855667-167855689 GAGGAAGGAAGGAAGGAAGGAGG + Intronic
1001059604 5:168477270-168477292 GTGAAATGGCAAAAGGGAGGGGG - Intergenic
1001123139 5:168996378-168996400 GTGGATGGGGGAAGGGAAGAGGG + Intronic
1001165306 5:169360293-169360315 GTGAGAGGGTGAGAGGAAGGTGG + Intergenic
1001234210 5:170015789-170015811 AGGGAAGGGAGAAAGGAGGGAGG - Intronic
1001254902 5:170176025-170176047 GTAGAAGGGAGAGAGGAAGTGGG - Intergenic
1001545940 5:172570664-172570686 GTTAAAGGGAGGAAGGAAGGAGG + Intergenic
1001637096 5:173218209-173218231 GAGGGAAGGAGAAAGGAAGGAGG - Intergenic
1001802887 5:174558910-174558932 GGGGAAGGAGGGAAGGAAGGAGG - Intergenic
1001802926 5:174559018-174559040 GTGGAAGGAAGGAAGGAGGGAGG - Intergenic
1002067641 5:176660132-176660154 GTGGATGGGTGAATGGATGGAGG - Intergenic
1002067649 5:176660159-176660181 GTGGATGGGTGAATGGATGGAGG - Intergenic
1002067657 5:176660186-176660208 GTGGATGGGTGAATGGATGGAGG - Intergenic
1002414976 5:179115605-179115627 GGGAGAGGGTGAAAGGAAGGAGG + Intronic
1002563132 5:180096150-180096172 CAGGAAGGGAGGAAGGAAGGAGG - Intergenic
1002858990 6:1063060-1063082 GGGGAAGAGGGAAATGAAGGAGG + Intergenic
1002863055 6:1096946-1096968 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
1003298141 6:4852428-4852450 TTGGAAGGAAGGAAGGAAGGAGG - Intronic
1003326492 6:5095734-5095756 TTGGAAGGCCGAGAGGCAGGTGG + Intergenic
1003709629 6:8574916-8574938 AAGGAAGGGAAAAAGGAAGGAGG - Intergenic
1003817812 6:9861933-9861955 GTGGAAGGTGAAAAGGAAGAAGG + Intronic
1004090370 6:12494525-12494547 GTGGTATGGCGAGAGGAAGGAGG - Intergenic
1004330235 6:14714464-14714486 GAGGAAGGAAGGAAGGAAGGAGG - Intergenic
1004378101 6:15108352-15108374 AAGGAAGTGAGAAAGGAAGGAGG + Intergenic
1004411604 6:15386266-15386288 GAGAGAGGGGGAAAGGAAGGGGG - Intronic
1004557329 6:16712060-16712082 GTGGAAAGTTGACAGGAAGGGGG + Intronic
1005014805 6:21365939-21365961 GTAGAAGGGGGAATGGAGGGTGG + Intergenic
1005042356 6:21610537-21610559 GTGTAAAGGAGAAAGAAAGGGGG - Intergenic
1005050141 6:21676947-21676969 AGGGAAGGGAGGAAGGAAGGAGG - Intergenic
1005158086 6:22831288-22831310 GTGGAAGGAAGGAAGGAAGGAGG - Intergenic
1005186311 6:23166551-23166573 GTGACAGGGCAAAAGAAAGGTGG - Intergenic
1005386842 6:25293714-25293736 GAGGAAGGGGGAAGGGAAGAGGG - Intronic
1005605979 6:27477854-27477876 GGAGAAGAGAGAAAGGAAGGAGG - Intergenic
1006281186 6:33054883-33054905 GTGACAGGGTGAAAGAAAGGCGG - Intergenic
1006430691 6:33993816-33993838 GAGGAAGGGCGGAAGGGAAGAGG - Intergenic
1006452463 6:34113077-34113099 AGGGAAGGGAGGAAGGAAGGAGG - Intronic
1006632025 6:35436629-35436651 GGGGCAGGGCCAAAGGGAGGAGG - Intergenic
1006681593 6:35800724-35800746 GAGGAAGGAAGGAAGGAAGGAGG - Intergenic
1006822308 6:36907049-36907071 ATGGAAGGAGGAAAAGAAGGAGG - Intronic
1007020689 6:38517832-38517854 GGGTAAGGGCAAAAGGAAGAAGG - Intronic
1007184870 6:39961181-39961203 TTAGAAGGGAGAAAAGAAGGGGG + Intergenic
1007228582 6:40331983-40332005 GTGGCTGGGAGAAAGGCAGGTGG - Intergenic
1007741027 6:44009589-44009611 GAGGAAGGGAGGTAGGAAGGAGG + Intergenic
1007741050 6:44009651-44009673 GAGGAAGGGAGAAGGGAAGGAGG + Intergenic
1008374750 6:50778788-50778810 GTGGAAGGAAGGAAGAAAGGGGG - Intergenic
1008392656 6:50970927-50970949 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
1008479421 6:51969543-51969565 GTGGGAGGGTGGAAAGAAGGTGG - Intronic
1008526798 6:52415483-52415505 GTGAAAGGGGAAAAGGAAAGTGG + Intergenic
1008717388 6:54305569-54305591 CTGGAAGGAAGAAAGGAAGATGG + Intergenic
1009058341 6:58366232-58366254 ATGGAAGGGCTAAAGTAATGAGG + Intergenic
1009314689 6:62203547-62203569 GTGGGTGGGGGAAAGGAGGGAGG + Intronic
1009408150 6:63333576-63333598 GAGGAAGGAAGGAAGGAAGGGGG + Intergenic
1009416882 6:63425617-63425639 GGGGAAGGGAGAAGGGAAGTAGG + Intergenic
1009618627 6:66043491-66043513 GTAGAAGGTAGAGAGGAAGGAGG - Intergenic
1009666369 6:66686350-66686372 AAGGAAGGAAGAAAGGAAGGAGG + Intergenic
1009826692 6:68875218-68875240 GAGGGAGGGGGAGAGGAAGGGGG - Intronic
1009828439 6:68897769-68897791 GAGGAAGGAAGGAAGGAAGGGGG + Intronic
1009878713 6:69538594-69538616 ATGGAACGGCAAAAGGTAGGAGG + Intergenic
1010357252 6:74948423-74948445 ATGGAAGGAAGGAAGGAAGGAGG + Intergenic
1010522798 6:76861555-76861577 GTGGAAGGGTGAAAGGGAGATGG + Intergenic
1010919866 6:81668191-81668213 GTGGATGAGAGAAAGGATGGTGG + Intronic
1011152135 6:84286244-84286266 AAGGAAGGGAGAAAGGAGGGAGG - Intergenic
1011398602 6:86936851-86936873 GTGGAAGGGGGGAAGAGAGGTGG - Intergenic
1011563479 6:88647741-88647763 GAGGAAGGGAGAGAGGGAGGAGG + Intronic
1011567417 6:88691268-88691290 GTGGAAGGCAAACAGGAAGGAGG - Intronic
1012987686 6:105892597-105892619 GTGGAAGAGACAAAGCAAGGAGG - Intergenic
1013537248 6:111074693-111074715 GAAGAAGGGAGAGAGGAAGGAGG + Intergenic
1013627187 6:111950078-111950100 GAGGAAGGGAGGAAGGAATGTGG - Intergenic
1014169653 6:118264953-118264975 TTGGAGGGGCTACAGGAAGGAGG - Intronic
1014249769 6:119103255-119103277 GTGGAAAGACGAAATGAAGCTGG + Intronic
1014287403 6:119515961-119515983 ATGGAAGGGAGAGAAGAAGGGGG - Intergenic
1014351580 6:120352817-120352839 GAGGGAGGGAGGAAGGAAGGAGG + Intergenic
1015163955 6:130182593-130182615 AAGGAAGGAAGAAAGGAAGGAGG + Intronic
1015364618 6:132384218-132384240 GAGGGAGGGAGGAAGGAAGGAGG - Intronic
1015364637 6:132384289-132384311 GAGGGAGGGAGGAAGGAAGGAGG - Intronic
1015383914 6:132600798-132600820 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
1015453317 6:133396013-133396035 GGGGAAGGGAGAAAAGAAGGGGG - Intronic
1015559388 6:134498108-134498130 GAGGAAGGAAGAAAGGAAGGTGG - Intergenic
1015645244 6:135380012-135380034 GAGGAAGGAAGGAAGGAAGGAGG - Intronic
1016021505 6:139240977-139240999 AGGGAAGGAAGAAAGGAAGGAGG - Exonic
1016312750 6:142751899-142751921 GTGGAAGGGGGAAAAGGAGATGG - Exonic
1016751270 6:147632945-147632967 AAGGAAGGAAGAAAGGAAGGAGG - Intronic
1016770693 6:147847163-147847185 AAGGAAGGGAGGAAGGAAGGAGG - Intergenic
1016878598 6:148888145-148888167 GTGGAAGGCAGAGAGGAAGCAGG + Intronic
1016919580 6:149278741-149278763 AAGGAAGGGTGAAAGGAAAGAGG + Intronic
1016995411 6:149959173-149959195 ATGGAAATGGGAAAGGAAGGGGG - Intergenic
1017014447 6:150088841-150088863 GGGGAAGGGGGAGAGGGAGGGGG + Intergenic
1017041241 6:150310122-150310144 GTGGAGGTGGGATAGGAAGGTGG - Intergenic
1017570597 6:155741002-155741024 AAGGAAGGGAGGAAGGAAGGAGG - Intergenic
1017624924 6:156338608-156338630 GAGGAAGGGAGGGAGGAAGGGGG - Intergenic
1017669979 6:156761777-156761799 GAGGAAGGAAGAAAGGAAGGAGG + Intergenic
1017709041 6:157149350-157149372 GTGGTAGGGTGAAAAAAAGGTGG - Intronic
1017920863 6:158870723-158870745 GAGGGAGGGAGAGAGGAAGGGGG - Intronic
1017979209 6:159384650-159384672 GTGGAAGGAAGATAGGAAAGAGG - Intergenic
1018069955 6:160155551-160155573 GGGAAAGGGAGAAAGGAAGAAGG + Intronic
1018335454 6:162783417-162783439 GTGGAGAGGAGAAAGAAAGGAGG - Intronic
1018465955 6:164045219-164045241 GTGGAAGGCAGAGAGGAAGCAGG + Intergenic
1018569997 6:165199571-165199593 GTGAAAGTGAGAAAGGATGGGGG + Intergenic
1018876668 6:167827329-167827351 GGGGGAGGGGGAAAGGAGGGCGG - Intronic
1019730536 7:2627247-2627269 GAGGGAGGGAGAAAGGAAGGAGG + Intergenic
1019920037 7:4157521-4157543 GAGGGAGGGAGGAAGGAAGGTGG + Intronic
1019947716 7:4343130-4343152 GAAGAAGGGAAAAAGGAAGGAGG - Intergenic
1020201913 7:6086655-6086677 AGGGAAGGGGGAAGGGAAGGAGG - Intergenic
1020201917 7:6086667-6086689 AGGGAAGGGGGAAGGGAAGGGGG - Intergenic
1020354130 7:7258264-7258286 ATGGAAGGGGGAAAGGAATGGGG + Intergenic
1021286407 7:18786646-18786668 GAGGAAGGGAGGAAAGAAGGAGG - Intronic
1021843549 7:24742750-24742772 GGGGAAGGGGAAAAGGGAGGCGG - Intronic
1022243574 7:28535368-28535390 GTGGAAGGGAGGAAGGGAGGAGG + Intronic
1023184976 7:37523797-37523819 GAGGAAGGAAGGAAGGAAGGAGG - Intergenic
1023275543 7:38515454-38515476 GTGGAGGGTGAAAAGGAAGGAGG - Intronic
1023910045 7:44547289-44547311 GAGGGAGGGGGAAGGGAAGGAGG + Intergenic
1023935133 7:44734295-44734317 AAGGAAAGGAGAAAGGAAGGGGG - Intergenic
1023991687 7:45132543-45132565 GAGGAAGGGAGGGAGGAAGGAGG + Intergenic
1024447631 7:49499907-49499929 GGGGAAGGGAAAAAGGAAGAGGG + Intergenic
1024960360 7:54968147-54968169 GTGGTGGGGAGAAAGGAAGCCGG + Intergenic
1025117174 7:56268360-56268382 ATGGAAGGAAGGAAGGAAGGAGG - Intergenic
1025117202 7:56268452-56268474 GAGGAGGGGAGGAAGGAAGGAGG - Intergenic
1025117241 7:56268564-56268586 GAGGAAGGGAGGAAGGAAGGAGG - Intergenic
1025142448 7:56477434-56477456 GTGGAAGGGGAAGAGGAAGCAGG - Intergenic
1025610956 7:63075257-63075279 GTGGAAGGGGAAGAGGAAGCAGG + Intergenic
1025708446 7:63887626-63887648 GTAGAAGGGGAAAAGGAAGCAGG - Intergenic
1025824186 7:64997519-64997541 CTGCAAGGGCTAAAGGAAGGTGG - Intronic
1026013381 7:66654196-66654218 GTGGTAGCGCGAATGGGAGGTGG - Intronic
1026017320 7:66681793-66681815 GTGGAAGCGCGAATGGGAGGTGG - Intronic
1026025360 7:66740362-66740384 GTGGTAGCGCGAATGGGAGGTGG - Intronic
1026112119 7:67466523-67466545 GAGGAAGGGAGAAGGGAAGGAGG - Intergenic
1026229225 7:68468948-68468970 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
1026268522 7:68816448-68816470 GAGGAAGGGAAAAAGGAGGGAGG + Intergenic
1026401079 7:70013553-70013575 TTGGAAGGGGAAATGGAAGGTGG + Intronic
1026571922 7:71538835-71538857 GAGGGAGAGAGAAAGGAAGGAGG + Intronic
1026588901 7:71679925-71679947 GAGGAAGGGAGAGAGGGAGGAGG - Intronic
1026588954 7:71680080-71680102 GAGGAAGGGAGAGAGGGAGGAGG - Intronic
1026803636 7:73415991-73416013 GAGAAAGAGAGAAAGGAAGGAGG + Intergenic
1026927558 7:74204517-74204539 AAGGAGGGGGGAAAGGAAGGAGG + Intronic
1028433514 7:90775631-90775653 GGGGAAGGGGGAGGGGAAGGGGG - Intronic
1029633848 7:101770716-101770738 AAGGAAGGAAGAAAGGAAGGAGG - Intergenic
1029697167 7:102221080-102221102 ATGGAAGGGCGGGTGGAAGGAGG - Intronic
1030099347 7:105931395-105931417 GAGGAAGGAAGAAAGGAAGGAGG - Intronic
1030246482 7:107389122-107389144 GTGACAGGGCGAAAGAAAGGCGG - Intronic
1030509906 7:110471236-110471258 GGGGGAGGGAGAGAGGAAGGAGG + Intergenic
1030509910 7:110471248-110471270 GAGGAAGGAGGGAAGGAAGGAGG + Intergenic
1030821456 7:114097658-114097680 GTGGAAGTGGGAATGGAAGGTGG - Intronic
1030824161 7:114134255-114134277 GTTCAAGAGAGAAAGGAAGGAGG + Intronic
1031623173 7:123960663-123960685 GGGGTATGGGGAAAGGAAGGAGG - Intronic
1032436787 7:131907335-131907357 GTGAGAGGGCAAAGGGAAGGAGG + Intergenic
1032708701 7:134444071-134444093 GTGGGAGGGGAAAAGGAAGACGG + Intronic
1032790966 7:135242131-135242153 GAGGAAGGGAGGAAGGAAGGAGG + Intronic
1033263667 7:139865852-139865874 GAGGGAGGGAGGAAGGAAGGAGG + Intronic
1033266907 7:139894681-139894703 GGGAAAGGGCAAAAGGAAGAAGG - Intronic
1033293895 7:140114176-140114198 GTGGAAAGGGGAGGGGAAGGGGG - Intronic
1034029645 7:147746506-147746528 GTAGAAGGGAGAAAGGTAGCAGG - Intronic
1034030905 7:147762733-147762755 GAGGGAGGGAGGAAGGAAGGAGG + Intronic
1034944932 7:155255673-155255695 GGGGAAGGGGGAGAGGGAGGGGG + Intergenic
1034995134 7:155572165-155572187 GAGGAAGGAAGAAAGGAGGGAGG + Intergenic
1034995139 7:155572184-155572206 GAGGAAGGAAGAAAGGAGGGAGG + Intergenic
1035231688 7:157469490-157469512 GTGGAGGGGGGACAGGCAGGCGG - Intergenic
1035389684 7:158496601-158496623 GGGGAGGGGCGCAGGGAAGGGGG - Intronic
1035518223 8:254935-254957 GTGGAAGGGAGAAATGGAAGAGG + Intergenic
1035673642 8:1439269-1439291 ATGGAAGAGGGAAGGGAAGGAGG + Intergenic
1035776342 8:2191386-2191408 GAGGAAGGGAGGAAGGGAGGGGG - Intergenic
1035776351 8:2191405-2191427 GGGGAAGGGAGGAAGGGAGGAGG - Intergenic
1035776531 8:2191753-2191775 GAGGAAGGGAGGAAGGGAGGGGG - Intergenic
1035776562 8:2191816-2191838 GAGGAAGGGAGGAAGGGAGGGGG - Intergenic
1036208100 8:6819872-6819894 GAGGAAGGAAGGAAGGAAGGAGG - Intronic
1036456468 8:8913272-8913294 GTGGAAGGGGAAGAGGAAGCAGG - Intergenic
1036581882 8:10082443-10082465 TTAGGAGGGCGAAAGGAAGGAGG - Intronic
1036607016 8:10316592-10316614 GAGGAAGGGAGAGAGGGAGGGGG - Intronic
1036779904 8:11639291-11639313 GAGAAAGAGAGAAAGGAAGGAGG - Intergenic
1037098917 8:15018879-15018901 GTGGAAGGCGGAGAGGAAGAAGG + Intronic
1037272754 8:17147385-17147407 CTGGAAGGACAAAGGGAAGGTGG - Intergenic
1037821770 8:22138610-22138632 GTGGGAGGACGACAGGAGGGAGG - Intronic
1037867435 8:22457082-22457104 GGGGAAGGAGGGAAGGAAGGAGG - Intronic
1037886518 8:22599038-22599060 GGGGAGGGGCGAGAGGAGGGAGG - Intronic
1037886654 8:22599395-22599417 GGGGAGGGGCGAGGGGAAGGGGG - Intronic
1037920011 8:22799189-22799211 GTGGAAGGGAGGACGGCAGGAGG - Intronic
1038914476 8:32005131-32005153 ATGGAAGAGAGGAAGGAAGGAGG + Intronic
1039435992 8:37559580-37559602 GGGGGAGGGGGAAAAGAAGGAGG + Intergenic
1039473813 8:37829035-37829057 GTGGGGGGGTGAGAGGAAGGGGG - Intronic
1039779534 8:40770478-40770500 GAGGGAGGGAGGAAGGAAGGAGG - Intronic
1039818982 8:41119555-41119577 GAGGAAGGGGGAAAGGGAGAGGG - Intergenic
1039931982 8:42001008-42001030 GAGGAAGGAGGGAAGGAAGGAGG + Intronic
1040984306 8:53277385-53277407 GGGAAAGGAAGAAAGGAAGGAGG + Intergenic
1041174596 8:55181445-55181467 CTGGAAGGATGAAAGGAAGGAGG - Intronic
1041225325 8:55691947-55691969 GTGGCAGAGGGAAAGGAAGTTGG - Intergenic
1041321481 8:56618519-56618541 GAGGGAGGGAGGAAGGAAGGAGG - Intergenic
1041670829 8:60490128-60490150 GTGGAAGGTGAAAAGGAAGCAGG + Intergenic
1042101990 8:65283884-65283906 GAGGAAGGGAGAGGGGAAGGAGG + Intergenic
1042230084 8:66545887-66545909 ATGGAAGGAAGGAAGGAAGGAGG + Intergenic
1042747067 8:72119650-72119672 GTGGAAAGGAGAAAGCAAAGGGG - Intergenic
1042893983 8:73645804-73645826 GAGGAAGAGAGAAAGGAGGGAGG + Intronic
1043037673 8:75218761-75218783 ATGGAAGGAAGGAAGGAAGGAGG + Intergenic
1043274168 8:78372682-78372704 GAGGGAGCGAGAAAGGAAGGAGG + Intergenic
1043546821 8:81324654-81324676 GTGGGAGGGTGAAAGAAGGGTGG - Intergenic
1044152428 8:88798019-88798041 GAGGAAGGAAGAAAGGAGGGAGG - Intergenic
1044506149 8:93022249-93022271 GTGGAAGGGGGAGACGGAGGTGG + Intergenic
1044582753 8:93838453-93838475 GTGGAAGGGAAAGAGGAAGCAGG + Intergenic
1044728128 8:95209275-95209297 GGGGATGGGCGATAGGTAGGTGG + Intergenic
1044885936 8:96777416-96777438 ATGGAAGGGGAAAGGGAAGGAGG + Intronic
1044983225 8:97736337-97736359 GAGGGAGGGTGAAGGGAAGGGGG + Intergenic
1045233097 8:100324850-100324872 GAGAAAGAGAGAAAGGAAGGAGG - Intronic
1045755116 8:105533706-105533728 GAGGGAGGGAGAAAGTAAGGAGG - Intronic
1045755179 8:105533916-105533938 GAGGGAGGGAGAAAGGAAGAAGG - Intronic
1045755258 8:105534150-105534172 GAGGAAGAGAGAAAGGAGGGAGG - Intronic
1045755264 8:105534173-105534195 GAGGAAGGGAGGAGGGAAGGAGG - Intronic
1046094406 8:109540056-109540078 GTGGAAGGGCGAAAGGAAGGTGG - Intronic
1046489872 8:114937483-114937505 AAGGAAGGAAGAAAGGAAGGAGG + Intergenic
1047041326 8:120999285-120999307 CTGGAACGACTAAAGGAAGGAGG + Intergenic
1047066688 8:121291982-121292004 AAGGAAGGAAGAAAGGAAGGAGG - Intergenic
1047511855 8:125521665-125521687 GGGGAAGGACGGGAGGAAGGAGG - Intergenic
1047573858 8:126131739-126131761 ATGGAAGGGAGGAAGGAAAGAGG + Intergenic
1047938956 8:129808768-129808790 GTGGAAGGTGGAAAGGGAGCAGG - Intergenic
1048127004 8:131646962-131646984 CAGGAAGGCAGAAAGGAAGGCGG + Intergenic
1048165918 8:132061349-132061371 GAGGGAGAGGGAAAGGAAGGAGG - Intronic
1048761964 8:137804987-137805009 GAGGAAGGAAGGAAGGAAGGGGG + Intergenic
1049053509 8:140217323-140217345 CTGGAATGGCACAAGGAAGGTGG + Intronic
1049128741 8:140817078-140817100 GAGGAAGGGGCAAAGAAAGGCGG + Intronic
1049210751 8:141385405-141385427 GAGGGAGGGAGAAAGGAGGGAGG - Intergenic
1049853907 8:144849783-144849805 GTGGAGGGGTGCAAGGGAGGAGG - Intronic
1049909116 9:248446-248468 GAGGAAGGAAGGAAGGAAGGAGG - Intronic
1050172455 9:2836133-2836155 GAGGTAGGGAGAGAGGAAGGAGG - Intronic
1050876199 9:10640022-10640044 GTGGAAGGTACAGAGGAAGGAGG + Intergenic
1050925292 9:11256511-11256533 GTGGCAGGGTGAAAGAAAGGTGG + Intergenic
1051295546 9:15591660-15591682 ATGGGAGGGAGGAAGGAAGGAGG - Intronic
1051395590 9:16616730-16616752 AAGAAAGGGGGAAAGGAAGGAGG + Intronic
1052137853 9:24937450-24937472 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
1052211306 9:25906881-25906903 AAGGAAGGAAGAAAGGAAGGGGG + Intergenic
1053003741 9:34591339-34591361 GTGGACGCGGGGAAGGAAGGGGG + Intergenic
1053185125 9:36009484-36009506 GAGGAAGGGAGAGAAGAAGGGGG + Intergenic
1053229729 9:36397626-36397648 GTGGACTGGGGAAAGGAAGTAGG - Intronic
1054923351 9:70563708-70563730 GAGGAAGGGAGAAAGGAAATGGG + Intronic
1055193241 9:73553245-73553267 GAGGAAGGAAGGAAGGAAGGAGG - Intergenic
1055513785 9:77018327-77018349 AGGGAAGGGTAAAAGGAAGGGGG + Intergenic
1055930586 9:81555927-81555949 GTAGAAGGAGGAGAGGAAGGAGG - Intergenic
1056102761 9:83315600-83315622 GTGGAAGGCAAAGAGGAAGGAGG - Intronic
1056107641 9:83362883-83362905 GAGGAAGGAGGGAAGGAAGGAGG - Intronic
1056137737 9:83646559-83646581 GGGGAAGAGGGAAAGGAAGAGGG + Intergenic
1056179754 9:84070731-84070753 GTGGAAGGTGAAGAGGAAGGAGG + Intergenic
1056497684 9:87176176-87176198 GTGGAAGGCAAAAAGGAAGCAGG - Intergenic
1056507124 9:87268034-87268056 ATGGAAGGGCGGAAGAGAGGGGG + Intergenic
1056788543 9:89610588-89610610 GGGGAAGGGGGAAAGAAAGGAGG - Intergenic
1056859094 9:90163196-90163218 GAGGAAGGGAGGAAGGAAGAAGG + Intergenic
1056882832 9:90413838-90413860 GTAGAAGGACGAATGGAGGGTGG - Intergenic
1057234696 9:93348868-93348890 GTAGAAGGACGAATGGAGGGTGG - Intergenic
1057379551 9:94555536-94555558 GATGAAGGGGGAAAAGAAGGTGG + Intergenic
1057385182 9:94600379-94600401 CTGGAAGGCCCAGAGGAAGGGGG + Intergenic
1057448664 9:95137372-95137394 GGGGAAGGGAGAAGGGAGGGAGG + Intronic
1057565093 9:96160242-96160264 GGGGAAGGAAGGAAGGAAGGAGG + Intergenic
1057568320 9:96184431-96184453 GTGGAAGGAGGGTAGGAAGGTGG + Intergenic
1057881803 9:98797554-98797576 GAGGGAGGGAGGAAGGAAGGGGG - Intergenic
1057931282 9:99195830-99195852 GAGGAAGGAAGACAGGAAGGGGG - Intergenic
1058454917 9:105130041-105130063 GAGGAAGAACAAAAGGAAGGAGG + Intergenic
1059380011 9:113915715-113915737 GGGGAAGGAGGAAAGGAGGGAGG + Intronic
1059701070 9:116775733-116775755 GGGGAAGGGAGGAAGGAAGGAGG + Intronic
1059980411 9:119765542-119765564 GAGGAAGGGAGAAAGGGTGGGGG - Intergenic
1060023891 9:120155009-120155031 GAGGGAGGGAGGAAGGAAGGAGG + Intergenic
1060088283 9:120720974-120720996 CTGGAAGGGCAAAATGAAAGAGG + Intergenic
1060116137 9:120942513-120942535 GGGGAAGGGAGAAAGGAAGGAGG + Intergenic
1060190341 9:121588571-121588593 GGTGAAGGGGGAAGGGAAGGGGG + Intronic
1060527180 9:124327263-124327285 GGGGCAGGACGAGAGGAAGGGGG - Intronic
1060850726 9:126873100-126873122 ATGCAAGGACAAAAGGAAGGTGG - Intronic
1060858235 9:126933103-126933125 GTGAGAGGACAAAAGGAAGGCGG + Intronic
1060967688 9:127720913-127720935 GGGGAAGGGAGGAAGGGAGGAGG - Intronic
1060970821 9:127736741-127736763 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
1061491031 9:130944469-130944491 GTGGAAGGGTGGAAGGGTGGAGG + Intergenic
1061714392 9:132509836-132509858 GTGGAAGGGGGAAAAGATGGGGG - Intronic
1062074787 9:134579892-134579914 GGGGAAGGGGGAAGAGAAGGAGG + Intergenic
1062097828 9:134712016-134712038 GAAGAAGGGGGGAAGGAAGGAGG - Intronic
1062097929 9:134712315-134712337 GAGGGAGGGGGACAGGAAGGAGG - Intronic
1062449150 9:136608284-136608306 GAGGAAGGGAGGGAGGAAGGGGG + Intergenic
1185486007 X:482061-482083 GAGGGAGGGAGGAAGGAAGGAGG + Intergenic
1185698617 X:2213956-2213978 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
1185766834 X:2732483-2732505 GAGGGAGGGGGAAAGAAAGGAGG - Intronic
1185772224 X:2773424-2773446 GAGGAAGGAAGAAAGGAGGGTGG + Intronic
1186020081 X:5245246-5245268 AAGGAAGGACTAAAGGAAGGGGG - Intergenic
1186065024 X:5754060-5754082 GAGGAAGGAGGGAAGGAAGGAGG - Intergenic
1186145625 X:6621587-6621609 GAGGAAGGAAGAAAGGAAGGAGG + Intergenic
1186246742 X:7622911-7622933 GAGGAAGGAAGGAAGGAAGGAGG - Intergenic
1186269186 X:7866470-7866492 AAGGAAGGGAGAGAGGAAGGGGG - Intergenic
1186309023 X:8297156-8297178 GAGGGAGGGAGGAAGGAAGGGGG - Intergenic
1186477824 X:9872141-9872163 GTGGGAGGGGGAAAGAAAGCTGG + Intronic
1186489398 X:9959694-9959716 GGGGAAGGAAGGAAGGAAGGTGG - Intergenic
1186624006 X:11272493-11272515 GTGGAAGGGTGCAAGAAATGAGG - Intronic
1187034341 X:15522195-15522217 GAGGAAGGGAGGAAGGAAAGAGG - Intronic
1187077168 X:15946955-15946977 GCGGAAAGGGGAAAGGAAAGGGG + Intergenic
1187132245 X:16514147-16514169 GAGGAAGGGGGGAGGGAAGGGGG + Intergenic
1187251316 X:17600738-17600760 GGGGAGGGAGGAAAGGAAGGAGG + Intronic
1187264573 X:17719063-17719085 GAAGAAGGGAGGAAGGAAGGAGG + Intronic
1187323016 X:18257960-18257982 AGGGAAGGGGGAAGGGAAGGGGG + Intronic
1187323022 X:18257972-18257994 AGGGAAGGGGGAAGGGAAGGGGG + Intronic
1187323028 X:18257984-18258006 AGGGAAGGGGGAAGGGAAGGGGG + Intronic
1187685002 X:21807323-21807345 GTGGGAGGGTGAGAGGAAGGGGG - Intergenic
1187704297 X:21993982-21994004 AAGGAAGGGGGAAAGGAGGGAGG - Intronic
1187747422 X:22424565-22424587 GTGGAAGGGTGATTGGATGGGGG + Intergenic
1187876008 X:23804833-23804855 GAGGGAGGGAGAAAGGAAAGAGG - Intergenic
1188740214 X:33769154-33769176 GAGGGAGGGAGAGAGGAAGGAGG + Intergenic
1188861550 X:35263048-35263070 GAGGAAGGAAGAAAAGAAGGTGG - Intergenic
1189229724 X:39442881-39442903 GAGGAAGGGAGGAAGAAAGGAGG + Intergenic
1189362350 X:40362575-40362597 GTGGAAGGGGGAATGGACTGGGG + Intergenic
1189403461 X:40694458-40694480 GAGCAAGGGAGAAAGGAAGCAGG - Intronic
1189712801 X:43831583-43831605 AAGGAAGGAAGAAAGGAAGGAGG + Intronic
1189751963 X:44231459-44231481 GAAGGAGAGCGAAAGGAAGGAGG - Intronic
1190071316 X:47282183-47282205 ATGGAAGGGAGAAAGGAAGGAGG - Intergenic
1190259810 X:48790776-48790798 GAGGAAGAGCGAGAGGAGGGAGG + Intronic
1190286946 X:48967588-48967610 GTGGCATGGAGAAAGGCAGGAGG - Intronic
1190336651 X:49266773-49266795 GTGGGAGGGAGCAAGGGAGGGGG + Intergenic
1190429936 X:50369519-50369541 GGGGAAGGAAGGAAGGAAGGAGG - Intronic
1190764240 X:53462821-53462843 GAGGAAGGAAGGAAGGAAGGAGG - Intergenic
1191210210 X:57876533-57876555 GTAACAGGGCGAAAGAAAGGCGG - Intergenic
1192050542 X:67720294-67720316 GGGGAAGGGGAAAAGAAAGGGGG - Intronic
1192199901 X:69060238-69060260 AGGGAAGGGGGAAAGGGAGGGGG + Intergenic
1192355935 X:70403801-70403823 TTGAAAGGGGGAAAGAAAGGTGG + Intronic
1192416427 X:70985051-70985073 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
1192442209 X:71182833-71182855 GGAGGAGGGGGAAAGGAAGGGGG + Intergenic
1192553089 X:72069381-72069403 GGGGGAGGGGGAAAGGGAGGGGG + Intergenic
1192616286 X:72626166-72626188 GAGGAAGAGAGAAAGGAAGGGGG + Intronic
1192640179 X:72854668-72854690 AAGGAAGGAAGAAAGGAAGGAGG + Intergenic
1192641532 X:72866137-72866159 AAGGAAGGAAGAAAGGAAGGAGG - Intergenic
1192717600 X:73660400-73660422 GTGACAGGGCGGAAGAAAGGCGG + Intronic
1192819052 X:74624038-74624060 GTGGAAGGGAGAAAGGAAGAAGG - Intergenic
1193351518 X:80470131-80470153 GTGACAGGGTGAAAGAAAGGCGG - Intergenic
1194125419 X:90010633-90010655 GTGGAAGGGAGAATGGGAAGAGG - Intergenic
1195161482 X:102175988-102176010 GTGACAGGGTGAAAGAAAGGCGG + Intergenic
1195455458 X:105064272-105064294 GTGGAAGGGGGAGAGAAAAGTGG - Intronic
1196456716 X:115896129-115896151 GTGGATGGGGGAAAAGAAGGTGG - Intergenic
1196846410 X:119899884-119899906 GTGGAAGGGCTACATGAAAGTGG - Intronic
1197207361 X:123801562-123801584 GAGGAAGGAGGGAAGGAAGGAGG + Intergenic
1197207407 X:123801680-123801702 GAGGAAGGAGGGAAGGAAGGAGG + Intergenic
1197226551 X:123961110-123961132 GGAGAAGGGAGAAAGGAGGGCGG - Intronic
1197707721 X:129646528-129646550 AGGGAAGGGCAGAAGGAAGGAGG - Exonic
1197816928 X:130507288-130507310 ATGGAAGGAAGGAAGGAAGGCGG - Intergenic
1198037751 X:132818649-132818671 GTGGAAGAGCAAAAGGCAAGAGG + Intronic
1198075668 X:133190778-133190800 GTGGAGGGGAGAAAGGAACTGGG - Intergenic
1198368412 X:135967036-135967058 GTGAAAGGGGGAAGGGAGGGGGG + Intronic
1198524416 X:137486073-137486095 GTGCCAAGGCGAAAGGAAGCAGG + Intergenic
1198597300 X:138250367-138250389 TTGGAAGGAAGCAAGGAAGGAGG + Intergenic
1199362533 X:146939818-146939840 GAGGAAGGAAGGAAGGAAGGAGG - Intergenic
1199599788 X:149535149-149535171 GTGGAAGAGAGAAGAGAAGGAGG - Intergenic
1199693350 X:150326031-150326053 GAGGAAGGAAGAAAGGAAGAAGG - Intergenic
1200044515 X:153394046-153394068 GTGGAAGGGGGAGAGGGAGCAGG - Intergenic
1200157438 X:153984706-153984728 GAGGGAGGGCGAAAAGAAGGCGG + Intergenic
1200656843 Y:5912662-5912684 GAGGGAGGGGGAAAGGGAGGGGG + Intergenic
1200820505 Y:7577865-7577887 GAGGAAGGAAGAATGGAAGGAGG + Intergenic
1200957525 Y:8967103-8967125 GAGGAAGGACAGAAGGAAGGAGG - Intergenic
1201550131 Y:15210501-15210523 GAGGAAGGAAGAAAGGGAGGAGG + Intergenic
1201741181 Y:17325901-17325923 GAGGAGGGAGGAAAGGAAGGAGG + Intergenic
1202349932 Y:23978456-23978478 GAGGAAGGAAGGAAGGAAGGAGG + Intergenic
1202520847 Y:25691665-25691687 GAGGAAGGAAGGAAGGAAGGAGG - Intergenic