ID: 1046095332

View in Genome Browser
Species Human (GRCh38)
Location 8:109552314-109552336
Sequence TCATCTCTGGATGATCACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046095326_1046095332 12 Left 1046095326 8:109552279-109552301 CCAGGGTATTGCAAGAGAACAAG 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1046095332 8:109552314-109552336 TCATCTCTGGATGATCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046095332 Original CRISPR TCATCTCTGGATGATCACTG GGG Intronic
No off target data available for this crispr