ID: 1046115610

View in Genome Browser
Species Human (GRCh38)
Location 8:109779823-109779845
Sequence CCAGCCAAGCATCACCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046115610 Original CRISPR CCAGCCAAGCATCACCTTGA TGG (reversed) Intergenic
900510634 1:3058672-3058694 CCATCAAAACATGACCTTGATGG + Intergenic
902851547 1:19161789-19161811 CCAGCAAATCTTCACCTTAAAGG + Intronic
904806079 1:33133464-33133486 CCAGCCCACCATCCCCATGAGGG - Intergenic
904979001 1:34480522-34480544 CCAGCCAAGCTTTACCTTTTAGG + Intergenic
906241864 1:44247345-44247367 CCAAACAAGAATCCCCTTGAGGG + Intronic
908207012 1:61860683-61860705 ACAGGCAAGCAACACCTTGCTGG - Intronic
914988974 1:152482029-152482051 CCTGCCAAGTTTTACCTTGAAGG - Intergenic
920941574 1:210488275-210488297 CCAGGTAAGCCTCACTTTGAAGG - Intronic
1063394663 10:5675871-5675893 ACAGGCAAGCACCACCATGACGG + Intergenic
1066043810 10:31579264-31579286 CCTGCCCAGAATCACCATGATGG + Intergenic
1067414134 10:46091183-46091205 CAAGCCCTGCCTCACCTTGAAGG - Intergenic
1067439509 10:46300632-46300654 CAAGCCTTGCCTCACCTTGAAGG + Intronic
1068577529 10:58700807-58700829 CCAGCCAAGCATTGCCATGTGGG + Intronic
1070554159 10:77515246-77515268 CAAACCAATCATCACCATGAGGG + Intronic
1074769257 10:116722905-116722927 CCAGCCAAGCGTCACCTTCCTGG - Intronic
1078846429 11:15122946-15122968 CCAGGCAAGCAAGACCTTGTAGG - Intronic
1079332869 11:19548007-19548029 CCAGCCACACATCACCTAGCTGG + Intronic
1084495517 11:69500979-69501001 CCAGGCAGGCATCACCCTGCAGG + Intergenic
1090552658 11:127840252-127840274 CCAGACAAGAAGCTCCTTGAGGG - Intergenic
1092045603 12:5430340-5430362 CCAGCCACACAGCACCATGAAGG - Intergenic
1093375937 12:18428198-18428220 CAAGCCAAGCATCATATTTAGGG + Intronic
1097227961 12:57490051-57490073 CCAGTCAAGCTGTACCTTGAAGG - Intronic
1098109031 12:67102253-67102275 CCACCCAAGTCTCATCTTGAAGG - Intergenic
1098353371 12:69585934-69585956 CCCGGCAGGCGTCACCTTGATGG + Intronic
1101738567 12:107482179-107482201 CCAGCCACTCATCAGCTGGAGGG - Intronic
1103724570 12:122991311-122991333 CCAGACAAGCCACACCTGGACGG + Intronic
1104928729 12:132327390-132327412 CCAGCCGATTCTCACCTTGAAGG + Intronic
1114629588 14:24150594-24150616 CCAGCAAAGCATCCCCCTGCTGG - Exonic
1117281468 14:54245609-54245631 CCTGGGAAGCATCCCCTTGAGGG + Intergenic
1118477140 14:66128133-66128155 CAAGCCAAGCATCAAATGGATGG + Intergenic
1120952935 14:90059703-90059725 CCAGCCAAACATCACCAACAGGG - Intergenic
1122290220 14:100676757-100676779 CCAGCCAGGCAGGAGCTTGAGGG - Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1133293661 16:4739061-4739083 GCACCCACCCATCACCTTGAAGG + Intronic
1135487346 16:22877784-22877806 TCAGACAAGCAACACCTTGAGGG - Intronic
1136566361 16:31073114-31073136 CCAGCCAGGCAGCCCCTGGAGGG + Intronic
1137717134 16:50604831-50604853 CCAGCCAGGGCTCAGCTTGAGGG + Intronic
1138331370 16:56218511-56218533 CGAGCCAAGTATCACGGTGATGG - Intronic
1139441923 16:66972696-66972718 GCAGCTAAGCCTCACCATGATGG + Exonic
1142404635 16:89880960-89880982 CCATCCCAGCAGCACCATGATGG - Intronic
1144021560 17:11242984-11243006 CCAGCCATCCATCAACATGAGGG - Intronic
1144803688 17:17949601-17949623 GCATCCAAGCCTCACCTTGCAGG + Intronic
1144949990 17:18988918-18988940 CCAGCCAAGCACCACCAACAGGG + Intronic
1146378944 17:32314477-32314499 CCAGCCGGGTATCACCTTTAAGG + Intronic
1146893741 17:36526134-36526156 CCAGCCACCTATCACCTGGAGGG + Intronic
1149600788 17:57891784-57891806 CTACTCAACCATCACCTTGAGGG + Intronic
1151599948 17:75100029-75100051 CCAGTCAAGCATCACGGTGCTGG + Exonic
1152490983 17:80633513-80633535 CCAGCGAAGCATGACCTAAACGG - Intronic
1153795472 18:8618077-8618099 CCAGCCACGCCTCTCCTTGGAGG + Intronic
1155532116 18:26777755-26777777 CCAGCGAAACTTCTCCTTGAAGG - Intergenic
1157515602 18:48308945-48308967 CCAGCCCAGCCTCACCCTGAGGG - Intronic
1159100121 18:63949256-63949278 CCAGCCAGGCACCACCTAGCGGG - Intergenic
1161958360 19:7508472-7508494 CCACCCAAGCATCCTCTGGATGG - Intronic
1168237432 19:55072067-55072089 CAGGCCAGGAATCACCTTGAAGG - Intronic
1168713341 19:58513841-58513863 CCAGCCCGGCACCACCTGGAGGG + Exonic
925517090 2:4694869-4694891 CCTGAGAAACATCACCTTGAAGG + Intergenic
936146956 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG + Intergenic
936197736 2:110384821-110384843 CCAGCCCAGCACCACCTGGAAGG - Intergenic
938116149 2:128604084-128604106 CCAGCCCAGCAGGACCATGATGG + Intergenic
938418952 2:131128139-131128161 CCAGCCCAGCAACAGTTTGATGG - Intronic
939111777 2:138017228-138017250 CCATCCAAGCCCCACCTTAAGGG + Intergenic
947271381 2:228339681-228339703 CCAGTGGAGCATCATCTTGAAGG - Intergenic
948040356 2:234896660-234896682 CCAGGCCAGGATCACCTGGACGG + Intergenic
1173729525 20:45318636-45318658 TCAGCCAAGATTCACCTTCAGGG - Intergenic
1178403875 21:32309293-32309315 ACAGCCCAACATTACCTTGAAGG + Intronic
1178586987 21:33879016-33879038 GCAGTCAAGCATCACCTCCAGGG - Intronic
1182966063 22:34522100-34522122 CCAGGGTAGCATAACCTTGAGGG - Intergenic
951046939 3:18050393-18050415 CCACCCAAGCCTCATCTTGTGGG - Intronic
954468026 3:50668530-50668552 CAAGCCCAGGATCTCCTTGAGGG + Intergenic
954668189 3:52271439-52271461 ACAGCCATGCATCACTTAGATGG - Intronic
954939019 3:54353862-54353884 AGAACCAAGCATCACCCTGAGGG - Intronic
956301336 3:67775502-67775524 CCAGTGAAGCCCCACCTTGAAGG - Intergenic
956343659 3:68253605-68253627 CCTGCCATGCATCACCATTAGGG - Intronic
964658263 3:159092108-159092130 CCAACCTAGCATCACCAAGAGGG + Intronic
965267413 3:166561445-166561467 TCAGCCAAACATCATCGTGAGGG + Intergenic
966135445 3:176693075-176693097 CCAGAAAAGCATAAACTTGAGGG + Intergenic
966315788 3:178644176-178644198 CCAGTCAAGCACCACCTTCTTGG - Intronic
967806319 3:193717181-193717203 CCATCCCAGCAGCACCTTGCAGG - Intergenic
968171768 3:196516324-196516346 CAAGCCAAGTACCACCTTCAGGG - Intergenic
968637959 4:1692123-1692145 CCAGCCCAGCATCACTTGGAGGG + Intergenic
972457464 4:39268780-39268802 CCATCAAATCATGACCTTGAGGG - Intronic
972636725 4:40890877-40890899 CCTACCAAGCATCCCCTCGATGG + Intronic
976071297 4:81242998-81243020 CCAGCCAACCATTGCTTTGATGG + Intergenic
983471131 4:168156821-168156843 CCAGCCAAACATCACCAAGATGG - Intronic
985042894 4:185910021-185910043 ACAGCCAGGCATGACATTGAAGG - Intronic
986661011 5:10060248-10060270 CCAGCCAAGCTCTACCATGAAGG + Intergenic
991169487 5:63604353-63604375 CCAGCCCAGCAGCAGCTTCAGGG - Intergenic
992447919 5:76850539-76850561 GGGGCCAAGCCTCACCTTGAAGG - Intronic
996897126 5:128498179-128498201 CCATGCAAGAATCACTTTGATGG - Intronic
998094181 5:139388046-139388068 AGAGCCAAGCATCAGCGTGATGG - Exonic
1001955554 5:175846065-175846087 CCAGCCAAGCCTCAAAATGAAGG - Intronic
1002299364 5:178248686-178248708 CCAGCCACGCATGCCCTTGAGGG + Intronic
1015326501 6:131929497-131929519 ACAGCCAAGCAGCAGCTTGAAGG + Intergenic
1025145200 7:56495801-56495823 CCCTGCAAGCATCACCTTGCTGG - Intergenic
1026159876 7:67859432-67859454 GCAGCCAAGAATCACCACGAGGG - Intergenic
1028037523 7:86003395-86003417 CCAGCCAAGCATTCTCCTGAGGG - Intergenic
1034350715 7:150413091-150413113 CCAGCCAGGCATTCCATTGACGG - Intergenic
1034521874 7:151626651-151626673 ACAGCCAAGCGTCAACTTGCAGG - Intronic
1035396180 7:158536554-158536576 CCAGCCCACCATCACCGAGACGG + Intronic
1037548603 8:19948315-19948337 CCAGCCATGGATCACCATGAAGG - Exonic
1038180392 8:25221950-25221972 CCAACCAAGACTCACCTTCAGGG + Intronic
1038515672 8:28185726-28185748 CCAGCCCAGCATCACCACGCGGG - Intronic
1043851427 8:85220658-85220680 CCAGCCAAGTCTCCCCTTGCTGG + Intronic
1044785457 8:95788174-95788196 CCCGCCAAACCTCAGCTTGAGGG - Intergenic
1046115610 8:109779823-109779845 CCAGCCAAGCATCACCTTGATGG - Intergenic
1047446427 8:124924216-124924238 CCAGCTTAGCATCACCTGGTGGG + Intergenic
1049445326 8:142627835-142627857 CCAGCCCGGGAGCACCTTGAGGG + Intergenic
1050415856 9:5416779-5416801 GCAGCCAAGGATCAGCTTGGTGG + Intronic
1053415002 9:37941851-37941873 CCGTCCAAGCATCCCCTTGTTGG - Intronic
1057017420 9:91664757-91664779 CCAGCCTGGCTTCAGCTTGAAGG - Intronic
1057702420 9:97373540-97373562 CCAGCCAAGGTTCACCTGCAGGG - Intronic
1058922185 9:109627681-109627703 CCAGTCAACCATCACCATGCAGG - Intergenic
1060589624 9:124808630-124808652 CCAGCTCAGCATCACCTTCCTGG - Intronic
1060836216 9:126756953-126756975 CCAGCTAAGCTGCACCTTGTAGG - Intergenic
1061014130 9:127972195-127972217 ACAGCCAAGCATCTCCCTGTGGG + Intronic
1061403848 9:130382990-130383012 CCAGCCAAGAATCACCTGTGAGG + Intronic
1062563991 9:137155828-137155850 CCAGACAGGCCTCACCTTGCAGG - Intronic
1062726902 9:138079401-138079423 CCAGCCATGCACCATATTGACGG + Intronic
1186945038 X:14556745-14556767 CCAACCAAGCATCACAGAGAGGG - Intronic
1192158940 X:68768653-68768675 ACTGCCAAGCATCAACTTGAAGG - Intergenic
1197459385 X:126721782-126721804 CCAGCCCAGCATCACACAGATGG - Intergenic