ID: 1046126779

View in Genome Browser
Species Human (GRCh38)
Location 8:109920189-109920211
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046126779_1046126784 -1 Left 1046126779 8:109920189-109920211 CCCTGCCTTTAAGGAGCTTACAC No data
Right 1046126784 8:109920211-109920233 CTCTGGTGGTAGAAGATAAATGG No data
1046126779_1046126785 27 Left 1046126779 8:109920189-109920211 CCCTGCCTTTAAGGAGCTTACAC No data
Right 1046126785 8:109920239-109920261 ATATGAAAAATTATAATTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046126779 Original CRISPR GTGTAAGCTCCTTAAAGGCA GGG (reversed) Intergenic
No off target data available for this crispr