ID: 1046126785

View in Genome Browser
Species Human (GRCh38)
Location 8:109920239-109920261
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046126779_1046126785 27 Left 1046126779 8:109920189-109920211 CCCTGCCTTTAAGGAGCTTACAC No data
Right 1046126785 8:109920239-109920261 ATATGAAAAATTATAATTAGTGG No data
1046126781_1046126785 22 Left 1046126781 8:109920194-109920216 CCTTTAAGGAGCTTACACTCTGG No data
Right 1046126785 8:109920239-109920261 ATATGAAAAATTATAATTAGTGG No data
1046126780_1046126785 26 Left 1046126780 8:109920190-109920212 CCTGCCTTTAAGGAGCTTACACT No data
Right 1046126785 8:109920239-109920261 ATATGAAAAATTATAATTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046126785 Original CRISPR ATATGAAAAATTATAATTAG TGG Intergenic
No off target data available for this crispr