ID: 1046128462

View in Genome Browser
Species Human (GRCh38)
Location 8:109939991-109940013
Sequence CTGGTTATTCAGAACACACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046128461_1046128462 -9 Left 1046128461 8:109939977-109939999 CCATATGTTGGATGCTGGTTATT No data
Right 1046128462 8:109939991-109940013 CTGGTTATTCAGAACACACACGG No data
1046128454_1046128462 28 Left 1046128454 8:109939940-109939962 CCTAGACCTATTAATCCTGGCTA No data
Right 1046128462 8:109939991-109940013 CTGGTTATTCAGAACACACACGG No data
1046128458_1046128462 13 Left 1046128458 8:109939955-109939977 CCTGGCTATGGGAAAAACAGTAC No data
Right 1046128462 8:109939991-109940013 CTGGTTATTCAGAACACACACGG No data
1046128457_1046128462 22 Left 1046128457 8:109939946-109939968 CCTATTAATCCTGGCTATGGGAA No data
Right 1046128462 8:109939991-109940013 CTGGTTATTCAGAACACACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046128462 Original CRISPR CTGGTTATTCAGAACACACA CGG Intergenic
No off target data available for this crispr