ID: 1046128677

View in Genome Browser
Species Human (GRCh38)
Location 8:109941632-109941654
Sequence AGTTATCTGAAGAAGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046128675_1046128677 4 Left 1046128675 8:109941605-109941627 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 1046128677 8:109941632-109941654 AGTTATCTGAAGAAGATTGTGGG No data
1046128671_1046128677 22 Left 1046128671 8:109941587-109941609 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 1046128677 8:109941632-109941654 AGTTATCTGAAGAAGATTGTGGG No data
1046128672_1046128677 16 Left 1046128672 8:109941593-109941615 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 1046128677 8:109941632-109941654 AGTTATCTGAAGAAGATTGTGGG No data
1046128673_1046128677 15 Left 1046128673 8:109941594-109941616 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 1046128677 8:109941632-109941654 AGTTATCTGAAGAAGATTGTGGG No data
1046128670_1046128677 25 Left 1046128670 8:109941584-109941606 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 1046128677 8:109941632-109941654 AGTTATCTGAAGAAGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046128677 Original CRISPR AGTTATCTGAAGAAGATTGT GGG Intergenic
No off target data available for this crispr