ID: 1046130564

View in Genome Browser
Species Human (GRCh38)
Location 8:109962815-109962837
Sequence TAATAGGCACAGATGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046130560_1046130564 3 Left 1046130560 8:109962789-109962811 CCTCGTAAAGTGAGGAAAGGCAG No data
Right 1046130564 8:109962815-109962837 TAATAGGCACAGATGGAGGTAGG No data
1046130559_1046130564 4 Left 1046130559 8:109962788-109962810 CCCTCGTAAAGTGAGGAAAGGCA No data
Right 1046130564 8:109962815-109962837 TAATAGGCACAGATGGAGGTAGG No data
1046130557_1046130564 8 Left 1046130557 8:109962784-109962806 CCAACCCTCGTAAAGTGAGGAAA No data
Right 1046130564 8:109962815-109962837 TAATAGGCACAGATGGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046130564 Original CRISPR TAATAGGCACAGATGGAGGT AGG Intergenic
No off target data available for this crispr