ID: 1046132335

View in Genome Browser
Species Human (GRCh38)
Location 8:109981729-109981751
Sequence ACTATGTTTTGACTTCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046132335_1046132336 -9 Left 1046132335 8:109981729-109981751 CCAGAGGGAAGTCAAAACATAGT No data
Right 1046132336 8:109981743-109981765 AAACATAGTAAATTTGTCACAGG No data
1046132335_1046132338 18 Left 1046132335 8:109981729-109981751 CCAGAGGGAAGTCAAAACATAGT No data
Right 1046132338 8:109981770-109981792 CTTTTTTTTTGATTGCTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046132335 Original CRISPR ACTATGTTTTGACTTCCCTC TGG (reversed) Intergenic
No off target data available for this crispr