ID: 1046134129

View in Genome Browser
Species Human (GRCh38)
Location 8:110004471-110004493
Sequence CAAAATGCTGATAGTGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046134129_1046134132 1 Left 1046134129 8:110004471-110004493 CCCACATCACTATCAGCATTTTG No data
Right 1046134132 8:110004495-110004517 TCACAACCATTCAAGTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046134129 Original CRISPR CAAAATGCTGATAGTGATGT GGG (reversed) Intergenic
No off target data available for this crispr