ID: 1046137184

View in Genome Browser
Species Human (GRCh38)
Location 8:110043227-110043249
Sequence CTGAGTGAGCTCTAGAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046137184_1046137187 9 Left 1046137184 8:110043227-110043249 CCTAATTTCTAGAGCTCACTCAG No data
Right 1046137187 8:110043259-110043281 CCTTTTATAAGATCCATCTGTGG No data
1046137184_1046137188 10 Left 1046137184 8:110043227-110043249 CCTAATTTCTAGAGCTCACTCAG No data
Right 1046137188 8:110043260-110043282 CTTTTATAAGATCCATCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046137184 Original CRISPR CTGAGTGAGCTCTAGAAATT AGG (reversed) Intergenic
No off target data available for this crispr