ID: 1046137916

View in Genome Browser
Species Human (GRCh38)
Location 8:110054489-110054511
Sequence CATTGTAACCAGAGGGTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046137916_1046137919 -2 Left 1046137916 8:110054489-110054511 CCTCATACCCTCTGGTTACAATG No data
Right 1046137919 8:110054510-110054532 TGTAAAAAAGTCAAATGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046137916 Original CRISPR CATTGTAACCAGAGGGTATG AGG (reversed) Intergenic
No off target data available for this crispr