ID: 1046146848

View in Genome Browser
Species Human (GRCh38)
Location 8:110171977-110171999
Sequence ACTAGGCAGTGCACCAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046146848_1046146854 -6 Left 1046146848 8:110171977-110171999 CCCCCACTGGTGCACTGCCTAGT No data
Right 1046146854 8:110171994-110172016 CCTAGTGGAGTTGTGAGAAGAGG 0: 72
1: 1708
2: 2071
3: 1437
4: 1002
1046146848_1046146855 -5 Left 1046146848 8:110171977-110171999 CCCCCACTGGTGCACTGCCTAGT No data
Right 1046146855 8:110171995-110172017 CTAGTGGAGTTGTGAGAAGAGGG 0: 81
1: 1795
2: 2063
3: 1336
4: 1052
1046146848_1046146858 21 Left 1046146848 8:110171977-110171999 CCCCCACTGGTGCACTGCCTAGT No data
Right 1046146858 8:110172021-110172043 CCATCCTCCAGACCCCAGAATGG 0: 723
1: 1254
2: 1570
3: 1362
4: 1119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046146848 Original CRISPR ACTAGGCAGTGCACCAGTGG GGG (reversed) Intergenic
No off target data available for this crispr