ID: 1046152387

View in Genome Browser
Species Human (GRCh38)
Location 8:110244651-110244673
Sequence GAAAGCAAGGTGCCAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046152387_1046152395 22 Left 1046152387 8:110244651-110244673 CCCACTTCTGGCACCTTGCTTTC No data
Right 1046152395 8:110244696-110244718 GCTTTCCTTTTGCTTATTAAGGG No data
1046152387_1046152394 21 Left 1046152387 8:110244651-110244673 CCCACTTCTGGCACCTTGCTTTC No data
Right 1046152394 8:110244695-110244717 AGCTTTCCTTTTGCTTATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046152387 Original CRISPR GAAAGCAAGGTGCCAGAAGT GGG (reversed) Intergenic
No off target data available for this crispr