ID: 1046152477

View in Genome Browser
Species Human (GRCh38)
Location 8:110246157-110246179
Sequence TTGAATAGGAATGAGGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046152474_1046152477 15 Left 1046152474 8:110246119-110246141 CCTGCGTGATTACTCTTGCTAGC No data
Right 1046152477 8:110246157-110246179 TTGAATAGGAATGAGGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046152477 Original CRISPR TTGAATAGGAATGAGGAGAG TGG Intergenic
No off target data available for this crispr