ID: 1046171403

View in Genome Browser
Species Human (GRCh38)
Location 8:110512273-110512295
Sequence AGGGATAAACGAATGGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046171398_1046171403 20 Left 1046171398 8:110512230-110512252 CCATTAGCAATATCATAAAACAT No data
Right 1046171403 8:110512273-110512295 AGGGATAAACGAATGGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046171403 Original CRISPR AGGGATAAACGAATGGCTCC TGG Intergenic
No off target data available for this crispr