ID: 1046171790

View in Genome Browser
Species Human (GRCh38)
Location 8:110517832-110517854
Sequence AAGGGCATTGAAACAAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046171790_1046171792 -5 Left 1046171790 8:110517832-110517854 CCTGATTTTGTTTCAATGCCCTT No data
Right 1046171792 8:110517850-110517872 CCCTTGAATGTCTATGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046171790 Original CRISPR AAGGGCATTGAAACAAAATC AGG (reversed) Intergenic
No off target data available for this crispr