ID: 1046173573

View in Genome Browser
Species Human (GRCh38)
Location 8:110545643-110545665
Sequence CCATGTGACTGCAGTAGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046173573_1046173579 23 Left 1046173573 8:110545643-110545665 CCAACTCTACTGCAGTCACATGG No data
Right 1046173579 8:110545689-110545711 CTACTGCCATTAGATAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046173573 Original CRISPR CCATGTGACTGCAGTAGAGT TGG (reversed) Intergenic
No off target data available for this crispr