ID: 1046187070

View in Genome Browser
Species Human (GRCh38)
Location 8:110734932-110734954
Sequence AGGTGCCCAAAGTTTCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046187059_1046187070 15 Left 1046187059 8:110734894-110734916 CCTCAGCTTCCAATCCTCGCCTC No data
Right 1046187070 8:110734932-110734954 AGGTGCCCAAAGTTTCAGAGGGG No data
1046187060_1046187070 6 Left 1046187060 8:110734903-110734925 CCAATCCTCGCCTCCCTCCATGA No data
Right 1046187070 8:110734932-110734954 AGGTGCCCAAAGTTTCAGAGGGG No data
1046187065_1046187070 -8 Left 1046187065 8:110734917-110734939 CCTCCATGAGCTCCTAGGTGCCC No data
Right 1046187070 8:110734932-110734954 AGGTGCCCAAAGTTTCAGAGGGG No data
1046187063_1046187070 -4 Left 1046187063 8:110734913-110734935 CCTCCCTCCATGAGCTCCTAGGT No data
Right 1046187070 8:110734932-110734954 AGGTGCCCAAAGTTTCAGAGGGG No data
1046187058_1046187070 16 Left 1046187058 8:110734893-110734915 CCCTCAGCTTCCAATCCTCGCCT No data
Right 1046187070 8:110734932-110734954 AGGTGCCCAAAGTTTCAGAGGGG No data
1046187064_1046187070 -7 Left 1046187064 8:110734916-110734938 CCCTCCATGAGCTCCTAGGTGCC No data
Right 1046187070 8:110734932-110734954 AGGTGCCCAAAGTTTCAGAGGGG No data
1046187061_1046187070 1 Left 1046187061 8:110734908-110734930 CCTCGCCTCCCTCCATGAGCTCC No data
Right 1046187070 8:110734932-110734954 AGGTGCCCAAAGTTTCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046187070 Original CRISPR AGGTGCCCAAAGTTTCAGAG GGG Intergenic
No off target data available for this crispr