ID: 1046194023

View in Genome Browser
Species Human (GRCh38)
Location 8:110835316-110835338
Sequence GTTGTCTGTGGAATTACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046194021_1046194023 -6 Left 1046194021 8:110835299-110835321 CCAGATGAAATGGCTTTGTTGTC No data
Right 1046194023 8:110835316-110835338 GTTGTCTGTGGAATTACCTGTGG No data
1046194013_1046194023 23 Left 1046194013 8:110835270-110835292 CCCTTCTGATCCAGATCCCAAAA No data
Right 1046194023 8:110835316-110835338 GTTGTCTGTGGAATTACCTGTGG No data
1046194015_1046194023 13 Left 1046194015 8:110835280-110835302 CCAGATCCCAAAAGAGTCCCCAG No data
Right 1046194023 8:110835316-110835338 GTTGTCTGTGGAATTACCTGTGG No data
1046194019_1046194023 -4 Left 1046194019 8:110835297-110835319 CCCCAGATGAAATGGCTTTGTTG No data
Right 1046194023 8:110835316-110835338 GTTGTCTGTGGAATTACCTGTGG No data
1046194016_1046194023 7 Left 1046194016 8:110835286-110835308 CCCAAAAGAGTCCCCAGATGAAA No data
Right 1046194023 8:110835316-110835338 GTTGTCTGTGGAATTACCTGTGG No data
1046194014_1046194023 22 Left 1046194014 8:110835271-110835293 CCTTCTGATCCAGATCCCAAAAG No data
Right 1046194023 8:110835316-110835338 GTTGTCTGTGGAATTACCTGTGG No data
1046194017_1046194023 6 Left 1046194017 8:110835287-110835309 CCAAAAGAGTCCCCAGATGAAAT No data
Right 1046194023 8:110835316-110835338 GTTGTCTGTGGAATTACCTGTGG No data
1046194020_1046194023 -5 Left 1046194020 8:110835298-110835320 CCCAGATGAAATGGCTTTGTTGT No data
Right 1046194023 8:110835316-110835338 GTTGTCTGTGGAATTACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046194023 Original CRISPR GTTGTCTGTGGAATTACCTG TGG Intergenic
No off target data available for this crispr