ID: 1046197552

View in Genome Browser
Species Human (GRCh38)
Location 8:110884193-110884215
Sequence CGTTATCTGCAGAAGAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046197552_1046197557 4 Left 1046197552 8:110884193-110884215 CCTGCCCTCTTCTGCAGATAACG No data
Right 1046197557 8:110884220-110884242 TCATTTTGAGGGACAGCTCTTGG No data
1046197552_1046197561 25 Left 1046197552 8:110884193-110884215 CCTGCCCTCTTCTGCAGATAACG No data
Right 1046197561 8:110884241-110884263 GGCCTGTTACTGGGCTTTGGTGG 0: 144
1: 161
2: 86
3: 68
4: 218
1046197552_1046197558 15 Left 1046197552 8:110884193-110884215 CCTGCCCTCTTCTGCAGATAACG No data
Right 1046197558 8:110884231-110884253 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
1046197552_1046197559 16 Left 1046197552 8:110884193-110884215 CCTGCCCTCTTCTGCAGATAACG No data
Right 1046197559 8:110884232-110884254 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
1046197552_1046197560 22 Left 1046197552 8:110884193-110884215 CCTGCCCTCTTCTGCAGATAACG No data
Right 1046197560 8:110884238-110884260 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
1046197552_1046197555 -8 Left 1046197552 8:110884193-110884215 CCTGCCCTCTTCTGCAGATAACG No data
Right 1046197555 8:110884208-110884230 AGATAACGACTCTCATTTTGAGG No data
1046197552_1046197556 -7 Left 1046197552 8:110884193-110884215 CCTGCCCTCTTCTGCAGATAACG No data
Right 1046197556 8:110884209-110884231 GATAACGACTCTCATTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046197552 Original CRISPR CGTTATCTGCAGAAGAGGGC AGG (reversed) Intergenic
No off target data available for this crispr