ID: 1046198482

View in Genome Browser
Species Human (GRCh38)
Location 8:110892540-110892562
Sequence GCTTTGCCCGGAAACTTATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046198477_1046198482 15 Left 1046198477 8:110892502-110892524 CCTTCACTGACTGGCCGCCATAA No data
Right 1046198482 8:110892540-110892562 GCTTTGCCCGGAAACTTATCCGG No data
1046198479_1046198482 -2 Left 1046198479 8:110892519-110892541 CCATAACCGTCAATAAATGCAGC No data
Right 1046198482 8:110892540-110892562 GCTTTGCCCGGAAACTTATCCGG No data
1046198478_1046198482 1 Left 1046198478 8:110892516-110892538 CCGCCATAACCGTCAATAAATGC No data
Right 1046198482 8:110892540-110892562 GCTTTGCCCGGAAACTTATCCGG No data
1046198480_1046198482 -8 Left 1046198480 8:110892525-110892547 CCGTCAATAAATGCAGCTTTGCC No data
Right 1046198482 8:110892540-110892562 GCTTTGCCCGGAAACTTATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046198482 Original CRISPR GCTTTGCCCGGAAACTTATC CGG Intergenic
No off target data available for this crispr