ID: 1046201598

View in Genome Browser
Species Human (GRCh38)
Location 8:110934791-110934813
Sequence AAGCTAAGCCCTCTCTAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046201598_1046201599 17 Left 1046201598 8:110934791-110934813 CCAATCTAGAGAGGGCTTAGCTT No data
Right 1046201599 8:110934831-110934853 TGCGTTCAATTGATGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046201598 Original CRISPR AAGCTAAGCCCTCTCTAGAT TGG (reversed) Intergenic
No off target data available for this crispr