ID: 1046202585

View in Genome Browser
Species Human (GRCh38)
Location 8:110946858-110946880
Sequence AGGCCCTTCTAGAAGACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046202575_1046202585 24 Left 1046202575 8:110946811-110946833 CCATTGCCCCTTTTATTCCAAAC No data
Right 1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG No data
1046202577_1046202585 18 Left 1046202577 8:110946817-110946839 CCCCTTTTATTCCAAACCATGGA 0: 8
1: 29
2: 32
3: 52
4: 208
Right 1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG No data
1046202581_1046202585 7 Left 1046202581 8:110946828-110946850 CCAAACCATGGAAAAAGGACCTA 0: 14
1: 15
2: 18
3: 7
4: 111
Right 1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG No data
1046202582_1046202585 2 Left 1046202582 8:110946833-110946855 CCATGGAAAAAGGACCTAACAAA 0: 39
1: 40
2: 27
3: 29
4: 254
Right 1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG No data
1046202579_1046202585 16 Left 1046202579 8:110946819-110946841 CCTTTTATTCCAAACCATGGAAA No data
Right 1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG No data
1046202578_1046202585 17 Left 1046202578 8:110946818-110946840 CCCTTTTATTCCAAACCATGGAA No data
Right 1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046202585 Original CRISPR AGGCCCTTCTAGAAGACTGA AGG Intergenic
No off target data available for this crispr