ID: 1046209753

View in Genome Browser
Species Human (GRCh38)
Location 8:111054359-111054381
Sequence CAGAATCAATTTAACCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046209753_1046209755 -4 Left 1046209753 8:111054359-111054381 CCTTCTTGGTTAAATTGATTCTG No data
Right 1046209755 8:111054378-111054400 TCTGAGGTATTTTATTTCTTTGG No data
1046209753_1046209756 27 Left 1046209753 8:111054359-111054381 CCTTCTTGGTTAAATTGATTCTG No data
Right 1046209756 8:111054409-111054431 GTAAATGAACTTAACTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046209753 Original CRISPR CAGAATCAATTTAACCAAGA AGG (reversed) Intergenic
No off target data available for this crispr