ID: 1046212293

View in Genome Browser
Species Human (GRCh38)
Location 8:111092706-111092728
Sequence CTGTGGATATGGAAGCAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046212293_1046212297 2 Left 1046212293 8:111092706-111092728 CCCTTTTGCTTCCATATCCACAG No data
Right 1046212297 8:111092731-111092753 AACCTGTCTGAAGTTTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046212293 Original CRISPR CTGTGGATATGGAAGCAAAA GGG (reversed) Intergenic
No off target data available for this crispr