ID: 1046213802

View in Genome Browser
Species Human (GRCh38)
Location 8:111115775-111115797
Sequence GGAAGAAACCGCTTTTGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046213799_1046213802 -5 Left 1046213799 8:111115757-111115779 CCACTAGCCACTAACCGAGGAAG No data
Right 1046213802 8:111115775-111115797 GGAAGAAACCGCTTTTGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046213802 Original CRISPR GGAAGAAACCGCTTTTGTAG TGG Intergenic
No off target data available for this crispr