ID: 1046221728

View in Genome Browser
Species Human (GRCh38)
Location 8:111225814-111225836
Sequence AAGCTCTTCTTGTGGACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046221725_1046221728 8 Left 1046221725 8:111225783-111225805 CCTGTTGAGATGCACCAGGAAGC 0: 1
1: 0
2: 0
3: 8
4: 180
Right 1046221728 8:111225814-111225836 AAGCTCTTCTTGTGGACAAAAGG 0: 1
1: 0
2: 0
3: 16
4: 159
1046221723_1046221728 19 Left 1046221723 8:111225772-111225794 CCAAAGTAAAACCTGTTGAGATG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1046221728 8:111225814-111225836 AAGCTCTTCTTGTGGACAAAAGG 0: 1
1: 0
2: 0
3: 16
4: 159
1046221726_1046221728 -6 Left 1046221726 8:111225797-111225819 CCAGGAAGCTTTGAGAGAAGCTC 0: 1
1: 0
2: 16
3: 29
4: 178
Right 1046221728 8:111225814-111225836 AAGCTCTTCTTGTGGACAAAAGG 0: 1
1: 0
2: 0
3: 16
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046221728 Original CRISPR AAGCTCTTCTTGTGGACAAA AGG Intergenic
902148460 1:14422970-14422992 AAACTATTGCTGTGGACAAAGGG - Intergenic
903312832 1:22473292-22473314 AAACTGTTCTAGTGGATAAAGGG + Intronic
906897884 1:49799167-49799189 AAGCTCTCTGTGTGGCCAAAGGG - Intronic
908364473 1:63404520-63404542 AAGCTCTTCATGCGTACAACAGG + Exonic
922015857 1:221645962-221645984 AAGCTCTTATTGTTGACAGAAGG - Intergenic
1063330246 10:5151433-5151455 AAGCTCTTCTTGTTCACTCATGG - Intergenic
1067066956 10:43109590-43109612 AAGATCTGCTTTTGCACAAAGGG - Intronic
1071686509 10:87763484-87763506 AAAATCTTCTTGTAGAGAAAGGG - Intronic
1074398804 10:113124115-113124137 AGGCTCTTTTTTTGGGCAAAAGG + Intronic
1074537414 10:114338457-114338479 AAAGTCGTCTTGTGGACATATGG - Intronic
1080264727 11:30388702-30388724 AAGCTCACCTGGTGGACAACAGG - Intronic
1080890507 11:36405081-36405103 AAGCTCTGTTTGTGGACAGCTGG + Intronic
1080941331 11:36921776-36921798 AAGCTCGACTGGTAGACAAAAGG + Intergenic
1083113036 11:60430711-60430733 AATATCTTCTTTTGGTCAAAAGG - Intronic
1083978113 11:66140891-66140913 AAGCTCTTCATGTGGACATGTGG - Intronic
1084779301 11:71398023-71398045 AGGCTCTTCATATGTACAAAGGG + Intergenic
1085179609 11:74522335-74522357 AAGCTCTTCAGGTAGAGAAAAGG + Intronic
1086256876 11:84887798-84887820 AGTCTCTTCTTGTGAAGAAACGG - Intronic
1086876039 11:92096783-92096805 AAGCTCACCATGTGGACAAAAGG + Intergenic
1086879631 11:92138216-92138238 AGGCTCTGCTTGTGGACATAGGG - Intergenic
1086971013 11:93080812-93080834 AACATGTTCTTCTGGACAAAGGG - Intergenic
1088840610 11:113624587-113624609 GGGCACTTCTTGTGGAGAAAAGG + Intergenic
1089400089 11:118159532-118159554 GAGTTCTTCCTGTGGGCAAATGG - Intergenic
1095366428 12:41411868-41411890 GAACTCTTCTTGTTGACAGAGGG + Intronic
1095613693 12:44163285-44163307 GAGATCATCTTGTAGACAAAAGG - Intronic
1098146902 12:67506665-67506687 AAGCTATGCTTGTGGAAAGATGG + Intergenic
1099408551 12:82294249-82294271 AAGCTCTTCTTTTGGACTCCTGG - Intronic
1100082970 12:90875618-90875640 AAGCTGTTCTTCTGGCAAAAAGG - Intergenic
1100665302 12:96745686-96745708 AAGCTATTTTTATTGACAAATGG - Intronic
1102924584 12:116816934-116816956 AAACTTTTCTTATGGGCAAAGGG - Intronic
1106678852 13:31989307-31989329 AAGCTCTTCTTCTCCACACAGGG - Intergenic
1106949292 13:34864917-34864939 AACCTGTACTTGGGGACAAAGGG - Intergenic
1109632001 13:65061743-65061765 CATCTCTTCTTGTAGACAAATGG + Intergenic
1110506110 13:76288721-76288743 AAGCTCCTTTTGTGGAAAGATGG + Intergenic
1118561693 14:67091711-67091733 TAGCTTTTCTTGTTGCCAAAGGG + Intronic
1125427240 15:39561285-39561307 AAGCTGTTCTTTTAGGCAAATGG - Intergenic
1126112630 15:45184795-45184817 AAGCTCTTCCTCTGGCCAGATGG + Intronic
1127540129 15:59929330-59929352 GAGCTTTTCTTCTTGACAAAGGG - Intergenic
1128491106 15:68145833-68145855 GTGATCTTCTTGTGGACAACTGG - Exonic
1134316500 16:13123750-13123772 AAGCCCTTCTTGTGGCAAAGTGG + Intronic
1134815737 16:17204295-17204317 ATGCTTTTCTTTTGGAGAAAGGG + Intronic
1140799200 16:78469765-78469787 AAGCTCTTCTTAGGGAAACAGGG - Intronic
1142166819 16:88595414-88595436 AAGATCTTCTGGTTTACAAATGG - Intronic
1142769410 17:2085827-2085849 AGGCTCTTCTTGTCCACAAAGGG + Exonic
1143692982 17:8586587-8586609 TATCTCTTCTTGGGTACAAAGGG - Intronic
1143984439 17:10899203-10899225 AATTTCTTCTTCTGGGCAAAAGG + Intergenic
1147447680 17:40484706-40484728 AAGGACTTCCTGGGGACAAAAGG - Intronic
1148724174 17:49776808-49776830 AAGCTCTTTGTGGGGTCAAAAGG + Intronic
1149254721 17:54812931-54812953 CAGCTCTTCTGTTGGACTAAAGG + Intergenic
1157050002 18:44152591-44152613 AAGCTCATAATGTGGATAAAAGG + Intergenic
1157227250 18:45878117-45878139 AACCTCTTATTGTGGAAAACTGG + Intronic
1157964858 18:52196578-52196600 AATATCTCCCTGTGGACAAAGGG + Intergenic
1158424455 18:57326520-57326542 AAGCTCTTATTTTGAACAAAAGG + Intergenic
1159261874 18:66024364-66024386 GAGCTCTTCTATTTGACAAAAGG - Intergenic
925241997 2:2339453-2339475 ATGCTCACCTTGTAGACAAAAGG + Intergenic
928295066 2:30075386-30075408 CAGGTCTTTTTGTGGACATATGG - Intergenic
928808098 2:35186484-35186506 AATCTTTTCTTCTGGACATATGG - Intergenic
930297417 2:49572291-49572313 AAGCTCTTCTTGGGGAAAACTGG - Intergenic
930369392 2:50484403-50484425 AAGCTATTCTTAAGGAGAAATGG + Intronic
930536793 2:52653674-52653696 AAGGTCTTCTTGGGGAAGAATGG + Intergenic
930865995 2:56122257-56122279 AACCTTTTATGGTGGACAAAGGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932597979 2:73106141-73106163 AAGGGCTTGCTGTGGACAAATGG + Intronic
933020864 2:77189373-77189395 AAGCCCTTGTTATGGACTAAAGG + Intronic
933675018 2:85047481-85047503 AAGCTCTTCTCATGGAAGAAAGG + Intronic
940390375 2:153125857-153125879 AATCTGTTCTTGTTGACAATGGG + Intergenic
941655058 2:168134398-168134420 CAGCTCTGCTTGAGGTCAAAGGG - Intronic
947612814 2:231534058-231534080 AACCTCCGCTTGTGGCCAAAGGG + Intergenic
947667778 2:231918103-231918125 AAGCTCTTCATGTGAACCATTGG + Intergenic
948223249 2:236289981-236290003 AAGCTCTTCTTGGTGATAACTGG - Intergenic
1169475759 20:5929883-5929905 TAGCTCTTATAGTGGACAAGGGG + Intergenic
1170088813 20:12567419-12567441 AAGCTCTTAGTGAGGAAAAAGGG + Intergenic
1173287377 20:41685434-41685456 AGTCTCTTCTTGAGGAGAAATGG - Intergenic
1174379350 20:50146724-50146746 ACGGTCTTCTTCTGCACAAAAGG - Intronic
1174606301 20:51764291-51764313 GAGCTCCTCTTGTGGTGAAATGG - Intronic
1174914925 20:54644198-54644220 AAGCTCTTCTTCTAGAGAAGTGG + Intronic
1175349996 20:58310489-58310511 TAACTCTTCCTGTGGAGAAAAGG + Intronic
1179419935 21:41227400-41227422 CAGCTCTAGTTGGGGACAAAAGG + Intronic
1181176900 22:21043117-21043139 AAGCTCTGCCTGTGGTCAAAGGG + Intergenic
949574420 3:5325044-5325066 AGGTTGTTCTTGTGGACCAAGGG - Intergenic
949695474 3:6689080-6689102 AAGGTCTTTTTGTGTACATATGG + Intergenic
950031798 3:9858652-9858674 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
950417125 3:12875152-12875174 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
951788046 3:26445210-26445232 AAGCTCTGTATGTGGACACATGG + Intergenic
952960784 3:38587914-38587936 AAGCCCTTCCTGTGGACACACGG - Intronic
954862442 3:53702143-53702165 GAGCTCTTGGTTTGGACAAAAGG + Intronic
955745833 3:62139654-62139676 AAGCTTTTCTTGTCGAAACACGG + Intronic
956844457 3:73169624-73169646 CTGTTCTTCTTGTGTACAAATGG + Intergenic
958535024 3:95389734-95389756 AACCTTTTAGTGTGGACAAAAGG - Intergenic
958959944 3:100499922-100499944 AAACTATTCTTGTGGTCAAATGG + Intronic
960537184 3:118827131-118827153 AAGCCCCTGGTGTGGACAAAAGG + Intergenic
961487084 3:127224179-127224201 TAGCTGTTCTTGTGGGCTAATGG - Intergenic
961783848 3:129337655-129337677 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
961785141 3:129343092-129343114 ACGCTCTTCTTGAGGCTAAAGGG - Intergenic
963231628 3:142914329-142914351 AAGCTCTTCTTATGCAGTAAGGG - Intergenic
965479640 3:169202031-169202053 AAGCTTTTATTGTTGACAAGTGG + Intronic
966663069 3:182436695-182436717 ATCCTCTTCTTGTTGACAGAAGG - Intergenic
966711420 3:182977252-182977274 AATTTCTTCTTGTGTAAAAATGG + Intronic
966733845 3:183173137-183173159 AAGTTCCTCTGGTGGACAACAGG + Intergenic
967283274 3:187843284-187843306 AAGCTCTGCTTGTGGATACTGGG + Intergenic
973188819 4:47363704-47363726 AAGTTCCTCTTGGGAACAAAAGG + Intronic
974405864 4:61468568-61468590 ATGCTATTATTTTGGACAAAGGG - Intronic
974440527 4:61910155-61910177 TAGATCTTCTTGTGGAAGAATGG + Intronic
974701208 4:65449802-65449824 AAGGCATTCTTGTGGAAAAAGGG - Intronic
975665772 4:76733424-76733446 AAGCACTGCATGGGGACAAAAGG + Intronic
976200228 4:82570626-82570648 AAGCTCCTCTTGTGCAGAAGTGG + Intergenic
976964067 4:91012910-91012932 AACTTCTTCTTGTGGGGAAATGG - Intronic
978966661 4:114749519-114749541 GAGCTCTTCTTGGGGAAGAATGG - Intergenic
980322288 4:131293762-131293784 AAGCTCTTGTGGTGGACACTGGG + Intergenic
981468600 4:145102457-145102479 AATGTCTTCTAGTGTACAAATGG + Intronic
981744595 4:148040251-148040273 AGGCTCTTCATGTGGAAATAGGG - Intronic
981917467 4:150050653-150050675 AGGCTCTGCTTCTAGACAAAAGG + Intergenic
984654978 4:182307960-182307982 AAGCTCTTCCTGACCACAAAAGG - Intronic
984983257 4:185302985-185303007 AAGTTCTTCTTGGGGAGAGAGGG - Intronic
985561993 5:592668-592690 TAGCTCTTCATGGGGATAAAAGG - Intergenic
986810418 5:11352413-11352435 AAGCTCTTCATCTGGATAAATGG + Intronic
988524945 5:31978800-31978822 AAGGTCTTCCTGCAGACAAAGGG - Intronic
989710774 5:44394435-44394457 TAGCTCTTGTTGTAGAGAAAAGG - Intergenic
991156605 5:63443936-63443958 AGGCTGTTGTTGTGTACAAAGGG + Intergenic
992007121 5:72488936-72488958 TAGCTCTTCTTTTGGGCACATGG + Intronic
996480925 5:123974015-123974037 CAGCTCTAGTTGTGGCCAAAAGG - Intergenic
997327608 5:133035028-133035050 AATCTCTTCTTGTGAATAATTGG + Intergenic
998589509 5:143462416-143462438 AAACTATTCTTGTTTACAAATGG - Intergenic
999301284 5:150492124-150492146 TAGCTCTTCCTCTGTACAAAGGG + Intronic
999699705 5:154217345-154217367 ACGCTCCTCTTGTGGAAAATGGG + Intronic
1003734220 6:8859479-8859501 AAGCTATATTTGTAGACAAATGG - Intergenic
1004279084 6:14265229-14265251 AAGCCCTTCTGGTGACCAAATGG + Intergenic
1005255760 6:24001403-24001425 AGGTGCTTCTTGAGGACAAATGG + Intergenic
1008557713 6:52690910-52690932 AAGATTTTCTTGTGGGCAATCGG - Intergenic
1008818652 6:55603630-55603652 AAGGTCTTCTTGGGGAAAACTGG + Intergenic
1009933968 6:70210662-70210684 AACACCATCTTGTGGACAAATGG - Intergenic
1010847938 6:80734280-80734302 TAACTCTTCTTGTGCACAAATGG - Intergenic
1012832869 6:104227894-104227916 AAGTTCCTCTTCTTGACAAAAGG + Intergenic
1016099720 6:140084079-140084101 AAGCACTTTTTATGGTCAAAAGG + Intergenic
1018373626 6:163191120-163191142 AAGCTGTTCTCCTGGACTAAGGG - Intronic
1020915851 7:14191667-14191689 AAACTCTTCTGGGGGACAAAGGG + Intronic
1021140958 7:17024264-17024286 AAGCTCTACTTCTGAGCAAAAGG - Intergenic
1021912665 7:25401763-25401785 AACCTCTTCCTGAGGACAGAAGG - Intergenic
1022283174 7:28930874-28930896 CAGCTTTTCTTGGGGACAGATGG - Intergenic
1022660667 7:32363601-32363623 AGGCTCTTCTTTTTAACAAATGG + Intergenic
1022827528 7:34031021-34031043 AAGTCCTTCATGTGGACAAAAGG + Intronic
1026117885 7:67511630-67511652 CAGCTCTGTTTGTGGACAAAGGG - Intergenic
1027497570 7:78907203-78907225 TAGCTCTTCTTTTGGAACAAAGG - Intronic
1029799474 7:102931126-102931148 AAGCACCACTTGGGGACAAAGGG + Intronic
1031824881 7:126551576-126551598 AAGCTCATCATGTCTACAAATGG + Intronic
1035704765 8:1667142-1667164 CAGCTCTTCCTGTGCACTAAAGG + Intronic
1043835391 8:85039417-85039439 AAGCTCTCTGTGTGTACAAAAGG - Intergenic
1046221728 8:111225814-111225836 AAGCTCTTCTTGTGGACAAAAGG + Intergenic
1046821821 8:118642202-118642224 CATCTCTTCTTGGGAACAAAGGG - Intergenic
1047163326 8:122407028-122407050 AAGTTCTTCATATGGACACAGGG + Intergenic
1047268636 8:123332952-123332974 AAGCCCTTCTTTTGAAAAAATGG - Intronic
1048069963 8:131011246-131011268 AGGCTCCTCATGTGGACACAGGG + Intronic
1049313347 8:141945826-141945848 AAGCTCTGCTTGTGAGAAAAGGG - Intergenic
1049432423 8:142571522-142571544 AAGGTCGTCTTCTGGACCAAGGG - Intergenic
1049671560 8:143872352-143872374 AAGCTCTTCTTGTGGCCTTCGGG + Exonic
1051243131 9:15081315-15081337 AATATCTTCTTTTGGGCAAATGG - Intergenic
1052488666 9:29135185-29135207 TACCTCTTCTTGTGCAGAAAGGG - Intergenic
1053784816 9:41646242-41646264 AACCTCTTCTTGGGGTCAACGGG - Intergenic
1054448398 9:65389252-65389274 AACCTCTTCTTGGGGTCAACGGG - Intergenic
1054664000 9:67720594-67720616 AACCTCTTCTTGGGGTCAACGGG + Intergenic
1055712622 9:79080858-79080880 AAGCTCTTCTTTTCTACCAAGGG - Intergenic
1059572602 9:115456400-115456422 AATCTCTTCTTGTAAACAGAAGG - Intergenic
1059588035 9:115627502-115627524 AAGCTCCTATTTTGGACCAAGGG + Intergenic
1186541542 X:10406139-10406161 AAGCTCTTTTAATGGACAATAGG - Intergenic
1190578892 X:51871153-51871175 AGTCTCTTCTTGAGGAGAAATGG - Intronic
1191226549 X:58050261-58050283 GAGGTCTTCTTGGGGAAAAATGG - Intergenic
1193360285 X:80572743-80572765 ATCCTCCTCTAGTGGACAAAAGG - Intergenic
1194190636 X:90832708-90832730 AAACTCTTTTTGGGGTCAAATGG + Intergenic
1194862432 X:99017541-99017563 GAGCATTTCTTGTTGACAAATGG - Intergenic
1194961416 X:100240620-100240642 AAGCTCCTCTTGTCAACAATGGG + Intergenic
1196072573 X:111542822-111542844 AACATTTTCTTGTTGACAAATGG + Intergenic
1196401555 X:115322458-115322480 CAGCTGTTCTTTTGGTCAAAAGG - Intergenic
1196625148 X:117869875-117869897 GATCTATTCTTGTGGAGAAATGG + Intergenic
1199007076 X:142713008-142713030 AAGGTTTTCTTGTTGATAAATGG + Intergenic
1199180129 X:144844597-144844619 AGGTTCTTCTTGTGGATAATAGG + Intergenic
1200537295 Y:4415129-4415151 AAACTCTTTTTGGGGTCAAATGG + Intergenic