ID: 1046222587

View in Genome Browser
Species Human (GRCh38)
Location 8:111235407-111235429
Sequence ATAATTAGTCTTTCTAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046222587_1046222589 25 Left 1046222587 8:111235407-111235429 CCTCCTTTAGAAAGACTAATTAT No data
Right 1046222589 8:111235455-111235477 TCTTTCACCTACCTGCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046222587 Original CRISPR ATAATTAGTCTTTCTAAAGG AGG (reversed) Intergenic