ID: 1046222754

View in Genome Browser
Species Human (GRCh38)
Location 8:111236838-111236860
Sequence ACTGACTAATAAATAGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046222752_1046222754 -2 Left 1046222752 8:111236817-111236839 CCCTACTGTTAGTGGTAGTTGAC No data
Right 1046222754 8:111236838-111236860 ACTGACTAATAAATAGCCCATGG No data
1046222753_1046222754 -3 Left 1046222753 8:111236818-111236840 CCTACTGTTAGTGGTAGTTGACT No data
Right 1046222754 8:111236838-111236860 ACTGACTAATAAATAGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046222754 Original CRISPR ACTGACTAATAAATAGCCCA TGG Intergenic
No off target data available for this crispr