ID: 1046226376

View in Genome Browser
Species Human (GRCh38)
Location 8:111285748-111285770
Sequence CTGGAGGCCTAGGGGTAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046226376_1046226383 -8 Left 1046226376 8:111285748-111285770 CCTTTTTACCCCTAGGCCTCCAG No data
Right 1046226383 8:111285763-111285785 GCCTCCAGGCCTGTGATGGGAGG 0: 393
1: 827
2: 1283
3: 1560
4: 1515
1046226376_1046226391 22 Left 1046226376 8:111285748-111285770 CCTTTTTACCCCTAGGCCTCCAG No data
Right 1046226391 8:111285793-111285815 ATGAAGGTCTCTGACTGCCCTGG No data
1046226376_1046226389 6 Left 1046226376 8:111285748-111285770 CCTTTTTACCCCTAGGCCTCCAG No data
Right 1046226389 8:111285777-111285799 GATGGGAGGGGCTGCCATGAAGG 0: 175
1: 345
2: 652
3: 748
4: 964
1046226376_1046226385 -7 Left 1046226376 8:111285748-111285770 CCTTTTTACCCCTAGGCCTCCAG No data
Right 1046226385 8:111285764-111285786 CCTCCAGGCCTGTGATGGGAGGG 0: 457
1: 862
2: 1342
3: 1611
4: 1606
1046226376_1046226386 -6 Left 1046226376 8:111285748-111285770 CCTTTTTACCCCTAGGCCTCCAG No data
Right 1046226386 8:111285765-111285787 CTCCAGGCCTGTGATGGGAGGGG 0: 452
1: 838
2: 1347
3: 1640
4: 1723

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046226376 Original CRISPR CTGGAGGCCTAGGGGTAAAA AGG (reversed) Intergenic
No off target data available for this crispr