ID: 1046227982 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:111311200-111311222 |
| Sequence | GTGGTGGTACAGGAGGTTAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1046227982_1046227993 | 29 | Left | 1046227982 | 8:111311200-111311222 | CCTTTAACCTCCTGTACCACCAC | No data | ||
| Right | 1046227993 | 8:111311252-111311274 | CTCTCTATTAAGGACTTATGAGG | No data | ||||
| 1046227982_1046227988 | 19 | Left | 1046227982 | 8:111311200-111311222 | CCTTTAACCTCCTGTACCACCAC | No data | ||
| Right | 1046227988 | 8:111311242-111311264 | GCCTCCTACCCTCTCTATTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1046227982 | Original CRISPR | GTGGTGGTACAGGAGGTTAA AGG (reversed) | Intergenic | ||