ID: 1046227983

View in Genome Browser
Species Human (GRCh38)
Location 8:111311207-111311229
Sequence CAAGTTGGTGGTGGTACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046227983_1046227993 22 Left 1046227983 8:111311207-111311229 CCTCCTGTACCACCACCAACTTG No data
Right 1046227993 8:111311252-111311274 CTCTCTATTAAGGACTTATGAGG No data
1046227983_1046227988 12 Left 1046227983 8:111311207-111311229 CCTCCTGTACCACCACCAACTTG No data
Right 1046227988 8:111311242-111311264 GCCTCCTACCCTCTCTATTAAGG No data
1046227983_1046227994 30 Left 1046227983 8:111311207-111311229 CCTCCTGTACCACCACCAACTTG No data
Right 1046227994 8:111311260-111311282 TAAGGACTTATGAGGTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046227983 Original CRISPR CAAGTTGGTGGTGGTACAGG AGG (reversed) Intergenic